CODE AT1TE00025 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00025 transposable_element ID=AT1TE00025; Name=AT1TE00025; Alias=ATREP3 COOR W/17024-18330,18643-18924 HITS SAIL_910_E11 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-147 LOCN 1000-Promotor COOR C/15529-15887,16260-16318 HITS SALKseq_048339.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/16096-16096 NOTE KO411991 Salk 30K 1:16099 GGTCAACTAGATTAGAATGGGATATATTCCTTAAGCATAAATCTATAATGGGATCTATATTGTGGTGTAAACAAATTGA HITS SALKseq_066122.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/16598-16598 NOTE KO342684 Salk 50K 1:16483 ACATATGGTGAGTATATATATATGTAAGATTTGAATCAAATGGTTAAAGTAGGGGTCAAATTGACGCTTAGACAACTT HITS SALKseq_059900.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/16772-16772 NOTE KO352357 Salk 40K 1:16719 AGAGTTTGTCCAAAACAGCCTCACATTTTTGCATCCCCACACTTCTCGATCTCTTTCACAATATATTGTGGTGTAAAC HITS SALK_126245.52.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-160 LOCN Exon COOR C/16866-17181 HITS SALK_075530.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-131 LOCN Exon COOR C/16867-17102 HITS SALK_076169.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-131 LOCN Exon COOR C/16867-17102 HITS FLAG_125G08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-08 LOCN 300-UTR5 COOR W/16871-16898 HITS Wiscseq_DsLoxHs090_09G.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17869-17869 NOTE KG814327 Wisc 20K 1:17869 GTGATTCAATTTTTAATACAAGCTGAAAAATCCTACAATTAACGGGTTTAAATCAATATTAATACAAGATGGTTACTACA HITS RATM11-5037-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Intron COOR C/17947-18151,18183-18526 HITS SALKseq_129412.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18119-18119 NOTE KO416351 Salk 20K 1:18119 AACTAAAATATAAGCCTACCTGCTGTATAATGCAAGTTAAAATTATAAATAAGCAGATTACCATCACGATGGATGTACC HITS RATM11-5037-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Intron COOR W/18519-18936 HITS SALK_149800.19.85.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-48 LOCN 300-UTR3 COOR C/18963-19091 HITS SALK_149800.19.85.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 7e-44 LOCN 300-UTR3 COOR C/18975-19091 HITS SAILseq_588_C07.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/19046-19046 NOTE KO325916 SAIL 30K 1:19085 AAAACCAGAGTGTGTATACGAATAAAAGTTGTGTATCACTGAACACACCAAATTTATATCTAGTCAACAATAGCATATATTGTGGTGTAATCAAT HITS SALKseq_076097.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/19083-19083 NOTE KO343133 Salk 70K 1:19086 GATTCTGATATTTCCTTCAAAAACCAGAGTGTGTATACGAATAAAAGTTGTGTACACATTGCGGTGTAAACAAATTGAC HITS SALK_076195.52.70.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-68 LOCN 300-UTR3 COOR W/19087-19256 HITS SALK_076097.29.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-44 LOCN 300-UTR3 COOR W/19093-19250