CODE AT1TE00020 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00020 transposable_element ID=AT1TE00020; Name=AT1TE00020; Alias=ATREP4 COOR C/16883-17009 HITS SALKseq_066122.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/16598-16598 NOTE KO342684 Salk 50K 1:16483 ACATATGGTGAGTATATATATATGTAAGATTTGAATCAAATGGTTAAAGTAGGGGTCAAATTGACGCTTAGACAACTT HITS SALKseq_059900.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/16772-16772 NOTE KO352357 Salk 40K 1:16719 AGAGTTTGTCCAAAACAGCCTCACATTTTTGCATCCCCACACTTCTCGATCTCTTTCACAATATATTGTGGTGTAAAC HITS SALK_126245.52.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-160 LOCN 300-UTR5 COOR C/16866-17181 HITS SALK_075530.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-131 LOCN 300-UTR5 COOR C/16867-17102 HITS SALK_076169.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-131 LOCN 300-UTR5 COOR C/16867-17102 HITS FLAG_125G08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-08 LOCN 300-UTR3 COOR W/16871-16898 HITS Wiscseq_DsLoxHs090_09G.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/17869-17869 NOTE KG814327 Wisc 20K 1:17869 GTGATTCAATTTTTAATACAAGCTGAAAAATCCTACAATTAACGGGTTTAAATCAATATTAATACAAGATGGTTACTACA