CODE AT1G03987.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G03987.1 lnc_RNA ID=AT1G03987.1; Parent=AT1G03987; Name=AT1G03987.1; locus_type=long_noncoding_rna COOR W/11101-11372 HITS SALKseq_093552.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/10113-10113 NOTE KO436075 Salk 80K 1:10114 CATACACAATCATACACACTTAACCCTACTTATAATGATGTAAACAAATTATATTCAGGATATATTGTGGTGTAAACA HITS SM_3_17469 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @] TYPE JIC SM Line EVAL e-135 LOCN 300-UTR5 COOR C/10597-10839 NOTE CS107143 HITS SM_3_15849 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @] TYPE JIC SM Line EVAL 0.0 LOCN 1000-Promotor COOR W/10783-11227 NOTE CS106444 HITS SM_3_15855 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @] TYPE JIC SM Line EVAL 0.0 LOCN 1000-Promotor COOR W/10783-11205 NOTE CS106450 HITS SM_3_34958 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @] TYPE JIC SM Line EVAL 0.0 LOCN 1000-Promotor COOR W/10783-11160 NOTE CS121669 HITS SM_3_36088 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @] TYPE JIC SM Line EVAL 2e-13 LOCN 300-UTR3 COOR C/11391-11428 NOTE CS122799 HITS FJ873733 [GenBank] TYPE Community cDNA EVAL 99.84 LOCN 300-UTR3 COOR C/11606-13173,13334-13613 HITS BX814729 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 300-UTR3 COOR C/11649-12972,13011-13175,13338-13613