CODE AT1G01060.5 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01060.5 CDS ID=AT1G01060.5; Parent=AT1G01060; Name=AT1G01060.5; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=6; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding COOR C/33992-34327,34401-35474,35567-35647,35730-35999,36090-36171,36624-36685,36810-36836 HITS RAFL07-43-F02 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.10 LOCN Exon COOR C/33379-33589,33981-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37111 HITS SALK_061415.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/33485-33821 HITS AJ006404 [GenBank] TYPE Community cDNA EVAL 97.86 LOCN Exon COOR C/33741-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37203,37373-37398,37569-37685 HITS RAFL04-17-F21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/33743-33968,33979-34329,34403-34533 HITS RAFL04-17-F21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.38 LOCN Exon COOR C/33743-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37203,37373-37779 HITS SALKseq_136918.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/33761-33761 NOTE KO343992 Salk 80K 1:33761 CATTATAAACTATTTATGATCTCATCAATCAATATCCACAATTTTTAAAAAGAAGAATAAAGACAAATCCATTGCTTA HITS BX836221 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/33770-34333,34405-34588 HITS BX835664 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/33794-34329,34403-34817 HITS SALKseq_061415.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/33821-33821 NOTE KO399289 Salk 40K 1:33772 AGTAGTAGCAGATGACATATAGACCACAAGTAGCATACACAAACAGAAGATTGGAGAAGTGGTGTAAACAAATTGACG HITS SALK_207003 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 5e-119 LOCN 300-UTR3 COOR W/33877-34107 NOTE JS807113.1 HITS SALKseq_130515.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/33889-33889 NOTE KO383857 Salk 50K 1:33890 AGACAAGACATGGGGTAATATGGTACAGAACCTGACATGACCAAAGAAATGTTCGGAAGGAACAAATTGACGCTTAGA HITS BX817115 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/33923-34326,34400-35474,35567-35647,35730-35963,36626-36685,36810-36920,37022-37204,37374-37395,37567-37828 HITS AY519507 [GenBank] TYPE Community cDNA EVAL 99.90 LOCN Exon COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS PYAt1g01060 [Seq] [About Peking Yale TF] [Order from ABRC] (ORF amplified by RT-PCR and cloned into the Gateway( TM) system; 5' and 3' end sequencing has been performed on this clone.) TYPE PY TF EVAL 0.0 LOCN Exon COOR C/33995-34326,34400-35474,35567-35647,35730-35965,36626-36685,36810-36923,37025-37061 HITS RATM11-5798-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-121 LOCN Exon COOR C/34001-34219 HITS RATM11-5798-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 2e-28 LOCN Exon COOR W/34217-34279 HITS RATM11-2925-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 2e-70 LOCN Exon COOR C/34276-34409 HITS RATM11-2925-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 4e-16 LOCN Exon COOR W/34411-34474 HITS SALK_149287.23.65.x SALK T-DNA Homozygous Knockout Line for At1g01060 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-79 LOCN Exon COOR W/34587-35011 NOTE At1g01060 HITS Wiscseq_DsLox418D03.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/35336-35336 NOTE KG803744 Wisc 10K 1:35328 CTCTCATAGGATGAAACATGAAGACTTGAGCTACCATACCTGAGGGATGATTTTGAGGGCGTTTTGCTATATTCCGGTTCACAGTATCTGCGTGTAGATG HITS GABI_106A07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 8e-23 LOCN Intron COOR W/35729-35939 NOTE - - HITS BX839544 [GenBank] [Order] TYPE GSLT cDNA EVAL e-140 LOCN Exon COOR C/35776-35908,36624-36685,36809-36920,37022-37204,37374-37396,37567-37826 HITS BX840279 [GenBank] [Order] TYPE GSLT cDNA EVAL e-104 LOCN Exon COOR C/35820-35965,36627-36685,36809-36920,37022-37204,37374-37396,37567-37757 HITS SALK_031092.55.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-145 LOCN Intron COOR C/36179-36438 HITS SALKseq_031092.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR W/36468-36468 NOTE KO394461 Salk 10K 1:36467 AGTTGCCTGTCACTGTCTGGAAAAGATGATAGAAGGTTCTTCTTATTCTTCCTTTTCTCTAAACAAATTGACGCTTAGA HITS RATM15-0447-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-132 LOCN 1000-Promotor COOR C/37050-37329 HITS FLAG_427B05 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR W/37277-37703 HITS RATM11-0101-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 2e-97 LOCN 1000-Promotor COOR C/37338-37532 HITS RATM11-3703-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-177 LOCN 1000-Promotor COOR C/37340-37653 HITS RATM11-0101-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 1000-Promotor COOR W/37525-38021 HITS RATM11-3703-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-180 LOCN 1000-Promotor COOR W/37646-38021