CODE AT1G01046.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01046.1 miRNA_primary_transcript ID=AT1G01046.1; Parent=AT1G01046; Alias=p_MI0005394; Name=ath-MIR838; symbol=MIR838A; curator_summary=Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA; Note=microRNA ath-MIR838 precursor; full_name=microRNA838A; Dbxref=locus:4515102484, locus:4515102484; locus_type=mirna COOR W/28500-28706 HITS GABI_725A02 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL e-180 LOCN 300-UTR5 COOR C/27703-28042,28099-28250 NOTE at1g01040 CS469506 HITS GABI_693A09 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN 300-UTR5 COOR C/27800-28299 NOTE at1g01040 CS466441 HITS GABI_725A02 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-67 LOCN 300-UTR5 COOR W/28250-28398 NOTE at1g01040 CS469506 HITS GABI_405E05 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-82 LOCN Exon COOR C/28390-28551 NOTE at1g01040 CS438837 HITS GABI_405E05 GABI-Kat T-DNA Homozygous Knockout Line for AT1G01040 by Salk [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat HM EVAL 2e-82 LOCN Exon COOR C/28390-28551 NOTE AT1G01040 CS438837 HITS RAFL07-36-P21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.54 LOCN Exon COOR W/28521-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31183 HITS GABI_405E05 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 6e-17 LOCN Exon COOR W/28558-28610 NOTE at1g01040 CS438837 HITS GABI_405E05 GABI-Kat T-DNA Homozygous Knockout Line for AT1G01040 by Salk [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat HM EVAL 6e-17 LOCN Exon COOR W/28558-28610 NOTE AT1G01040 CS438837 HITS GABI_441A06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-17 LOCN Exon COOR W/28558-28610 NOTE - - HITS GABI_418A01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-12 LOCN Exon COOR W/28572-28610 NOTE - - HITS GABI_428C04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-06 LOCN Exon COOR W/28572-28595 NOTE - - HITS GABI_434D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-13 LOCN Exon COOR W/28572-28610 NOTE - - HITS GABI_434C06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-09 LOCN Exon COOR W/28580-28610 NOTE - - HITS Wiscseq_DsLox329D04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/28822-28822 NOTE KG799046 Wisc 10K 1:28800 AACCTTTGATTAAAGGACGTGGTGTTTCGTATTGCAAGAACCTTCTTTCTCCTCGGTTTGAACAGTCAGGTTATAAGAAATTCTTTGTGGTGTAAACAAA