CODE AT1G01030.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01030.1 CDS ID=AT1G01030.1; Parent=AT1G01030; Name=AT1G01030.1; Note=AP2/B3-like transcriptional factor family protein; conf_class=2; symbol=NGA3; full_name=NGATHA3; computational_description=NGATHA3 (NGA3)%3B CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340)%3B BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1)%3B Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 1380%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11118137, PMID:15010618, PMID:16603651, PMID:16709272, PMID:16944199, PMID:18650403, PMID:19324928, PMID:19435937, PMID:20736450, PMID:22995285, PMID:24377444, PMID:25625546, locus:2200950; locus_type=protein_coding COOR C/11864-12940 HITS RATM11-4609-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR C/11576-12241 HITS FJ873733 [GenBank] TYPE Community cDNA EVAL 99.84 LOCN Exon COOR C/11606-13173,13334-13613 HITS BX814729 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/11649-12972,13011-13175,13338-13613 HITS SALKseq_046278.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/11933-11933 NOTE KO381801 Salk 20K 1:11785 AAATTGAGAGAAAGTGAAGACTTCCCTTTCTTAGCAAATTGATCATCATCGCCATCATCAACAAATTGACGCTTAGACA HITS SAIL_232_E10 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN Exon COOR C/11990-12533,12551-12720 HITS RATM11-4609-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-174 LOCN Exon COOR W/12239-12546 HITS SAIL_1278_G06C1 SAIL T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank (with the exact insertion site info)] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM NG EVAL 4e-78 LOCN Exon COOR W/12856-13018 NOTE JY085679.1 HITS SALKseq_071943.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/13086-13086 NOTE KO379853 Salk 50K 1:13085 GTCAATGGCTTTGAAAAACATCCGCAACAATTCACCAATTGAAGAACAAGAGAAAGGTTTAAACAAATTGACGCTTAG HITS FLAG_270B05 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-173 LOCN 1000-Promotor COOR W/13598-13907 HITS GABI_207G08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-05 LOCN 1000-Promotor COOR C/13899-13921 NOTE - -