CODE AT1G01020.4 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01020.4 CDS ID=AT1G01020.4; Parent=AT1G01020; Name=AT1G01020.4; Note=ARV1 family protein; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8442 HITS SALK_092270.19.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-31 LOCN 300-UTR3 COOR C/6463-6783 HITS RAFL14-93-B21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.07 LOCN Exon COOR C/6831-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8594-8715 HITS RAFL14-93-B21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-128 LOCN Exon COOR C/6833-7071,7159-7199,7208-7227,7379-7453,7567-7612 HITS SALKseq_092286.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/6841-6841 NOTE KO422694 Salk 10K 1:6706 CTTTTGATATTTTAGTAAGGTCTAATTCAATTTTTGGTGGCGATAATATTTGGCTTAGTCATAAACAAATTGACGCTTA HITS SALK_092262.22.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-168 LOCN 300-UTR3 COOR W/6847-7225 HITS SALK_092286.18.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-79 LOCN 300-UTR3 COOR W/6849-7193 HITS AY758070 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR C/6899-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8737 HITS SALKseq_138462.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/6957-6957 NOTE KO344068 Salk 60K 1:6908 ACTGGAAGCTGATGGGATCATACGATTCTGAAAAAATAAGACATATATTGCAACAGGATATATTGTGGTGTAAACAAAT HITS SALK_092263.15.50.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-22 LOCN Exon COOR W/7006-7227 HITS SALK_123517.23.25.x SALK T-DNA Homozygous Knockout Line for At1g01020 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 3e-57 LOCN Exon COOR W/7012-7227 NOTE At1g01020 HITS SALK_127981.13.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-12 LOCN Intron COOR C/7222-7275 HITS SALK_127977.13.65.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-07 LOCN Intron COOR C/7225-7254 HITS SALKseq_127979.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/7274-7274 NOTE KG795667 Salk 110K 1:7252 CTGACATTGGGAATTCCCATACCTGTAATAACAAAGATTCTCTATTTTTGAGCAAAGAGACATACAAATTGACGCTTAGACAA HITS SAIL_85_D10 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR5 COOR C/8049-8615 HITS SALK_116614.18.85.x SALK T-DNA Homozygous Knockout Line for At1g01020 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-07 LOCN Exon COOR C/8293-8392 NOTE At1g01020 HITS SAIL_28_C09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 7e-92 LOCN 300-UTR5 COOR W/8453-8695 HITS SALK_090151.51.50.x SALK T-DNA Homozygous Knockout Line for At1g01020 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-50 LOCN 300-UTR5 COOR C/8553-8652 NOTE At1g01020 HITS SALK_090152.50.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-50 LOCN 1000-Promotor COOR C/8553-8652,8909-8956 HITS SALKseq_090151.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/8677-8677 NOTE KO425721 Salk 80K 1:8678 CACATCCCACGCATCTGTGTTCACTCGCCGCCATTGCTCTCTCTCATATTGTCTAAGCAATGTGGTGTAAACAAATTG HITS SAIL_1277_H04 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-33 LOCN 1000-Promotor COOR C/8706-8814 HITS SAILseq_518_D11.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/8842-8842 NOTE KO328096 SAIL 30K 1:8915 CGCATTTTAAAATGCTATGTCATATGGACAAGATTTTGATCCAAATTGAACTATTTATAAATTACAACGTGTATATGATTTTTAAATTTTGGGGT HITS GABI_863H03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 1000-Promotor COOR C/8891-9401 NOTE - - HITS GABIseq_011H11.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/9133-9133 NOTE KG780077 GABI 10K 1:9111 AATATTATTACTGTCGTGTTACTTTCTATATATAGTTCATGACTTGTGAGTTGTGATGGATAAGTTTATAAGAAAATAAATTATTCAATTGTAAATGGCT HITS SK3707 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-154 LOCN 1000-Promotor COOR W/9407-9685 NOTE CS1000782 HITS SALKseq_79963.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/9407-9407 NOTE KO448808 Salk 80K 1:9404 TTGATTATTACTTTATTTAGAAATGTATTAGAAAGGGAAAGAACCCATAACACATTGACGCTTAGACAACTTAATTTG HITS SK15323 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-136 LOCN 1000-Promotor COOR W/9428-9683 NOTE CS1002699