CODE AT1G01010.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01010.1 CDS ID=AT1G01010.1; Parent=AT1G01010; Name=AT1G01010.1; Note=NAC domain containing protein 1; conf_class=2; symbol=NAC001; Alias=ANAC001, NAC domain containing protein 1; full_name=NAC domain containing protein 1; computational_description=NAC domain containing protein 1 (NAC001)%3B FUNCTIONS IN: sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: multicellular organismal development%2C regulation of transcription%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 7 plant structures%3B EXPRESSED DURING: 4 anthesis%2C C globular stage%2C petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441)%3B BEST Arabidopsis thaliana protein match is: NAC domain containing protein 69 (TAIR:AT4G01550.1)%3B Has 2503 Blast hits to 2496 proteins in 69 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 2502%3B Viruses - 0%3B Other Eukaryotes - 1 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11118137, PMID:12820902, PMID:15029955, PMID:15010618, PMID:15108305, PMID:15173566, PMID:15282545, PMID:16504176, PMID:16547105, PMID:16524982, PMID:16720694, PMID:16552445, PMID:17339215, PMID:17448460, PMID:17447913, PMID:18650403, PMID:20736450, PMID:24377444, locus:2200935; locus_type=protein_coding COOR W/3760-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5630 HITS GABI_289H03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-16 LOCN 1000-Promotor COOR C/2923-2965 NOTE - - HITS SAIL_864_B08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 1e-99 LOCN 300-UTR5 COOR C/3072-3271,3306-3645 HITS SAIL_872_H07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 1e-19 LOCN 1000-Promotor COOR C/3072-3129 HITS SAIL_872_D06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 8e-06 LOCN 1000-Promotor COOR C/3081-3115 HITS GABI_534H04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-47 LOCN 1000-Promotor COOR C/3114-3216 NOTE - - HITS SALKseq_045150.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/3266-3266 NOTE KO361640 Salk 20K 1:3269 GTGAACCGTGGATTGAATATCATCCTCTGTGAACCGTGGATTGAATATCGTCCGCAAGGTTAAACAAATTGACGCTTAG HITS R14978 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.87 LOCN Exon COOR W/3631-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5697 NOTE AF439834 HITS RAFL08-19-M04 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.16 LOCN Exon COOR W/3674-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5899 HITS PYAt1g01010 [Seq] [About Peking Yale TF] [Order from ABRC] (ORF amplified by RT-PCR and cloned into the Gateway( TM) system; 5' and 3' end sequencing has been performed on this clone.) TYPE PY TF EVAL 0.0 LOCN Exon COOR W/3760-3913,3996-4276,4486-4604,4705-5095,5174-5324,5437-5627 HITS U14978 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR W/3760-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5630 NOTE BT001115 HITS G14978 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/3760-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5630 NOTE U14978 BT001115 pENTR_Sfi HITS GABI_414G04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-44 LOCN Exon COOR W/3904-4008 NOTE - - HITS SALK_074723.37.35.x SALK T-DNA Homozygous Knockout Line for At1g01010 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-108 LOCN Intron COOR C/4101-4298 NOTE At1g01010 HITS SALK_128569.34.95.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-104 LOCN Intron COOR C/4101-4298 HITS SALK_128571.33.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-104 LOCN Intron COOR C/4101-4298 HITS SALKseq_128571.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/4304-4304 NOTE KO350304 Salk 60K 1:4204 ACGAGTTCCACTACGACCTCTTACCAGAACATCAGGTTTTCTTCTATTCATATATATATATATTGTGGTGTAAACAAAT HITS RATM11-4514-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR C/5099-5555 HITS SAIL_228_B11 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-150 LOCN Intron COOR W/5330-5598 HITS RAFL09-86-B21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 8e-59 LOCN Exon COOR W/5440-5610 HITS RAFL08-19-M04 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-115 LOCN Exon COOR W/5470-5679,5699-5753,5802-5899 HITS GT_5_106245 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 4e-90 LOCN Exon COOR W/5499-5685 NOTE CS180298 HITS RATM11-4514-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR W/5548-6189 HITS RATM11-2283-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-138 LOCN 300-UTR3 COOR C/5579-5929