CLON SALKseq_136918.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/33761-33761 NOTE KO343992 Salk 80K 1:33761 CATTATAAACTATTTATGATCTCATCAATCAATATCCACAATTTTTAAAAAGAAGAATAAAGACAAATCCATTGCTTA HITS At1g01060[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01060.1 CDS gene_syn LATE ELONGATED HYPOCOTYL, LATE ELONGATED HYPOCOTYL 1, LHY, LHY1, T25K16.6, T25K16_6 gene LHY function LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 go_process response to salt stress|GO:0009651|16463103|IEP go_process response to ethylene stimulus|GO:0009723|16463103|IEP go_process response to auxin stimulus|GO:0009733|16463103|IEP go_process response to abscisic acid stimulus|GO:0009737|16463103|IEP go_process response to gibberellin stimulus|GO:0009739|16463103|IEP go_process response to salicylic acid stimulus|GO:0009751|16463103|IEP go_process response to jasmonic acid stimulus|GO:0009753|16463103|IEP go_process regulation of circadian rhythm|GO:0042752|12007421|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process response to cadmium ion|GO:0046686|16463103|IEP go_process long-day photoperiodism, flowering|GO:0048574|19011118|IGI go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|9657154|ISS product Homeodomain-like superfamily protein note LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1); Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2; Bacteria - 257; Metazoa - 292; Fungi - 162; Plants - 1048; Viruses - 29; Other Eukaryotes - 679 (source: NCBI BLink). protein_id AT1G01060.1p transcript_id AT1G01060.1 protein_id AT1G01060.1p transcript_id AT1G01060.1 LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS At1g01060[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01060.2 CDS gene_syn LATE ELONGATED HYPOCOTYL, LATE ELONGATED HYPOCOTYL 1, LHY, LHY1, T25K16.6, T25K16_6 gene LHY function LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 go_process response to salt stress|GO:0009651|16463103|IEP go_process response to ethylene stimulus|GO:0009723|16463103|IEP go_process response to auxin stimulus|GO:0009733|16463103|IEP go_process response to abscisic acid stimulus|GO:0009737|16463103|IEP go_process response to gibberellin stimulus|GO:0009739|16463103|IEP go_process response to salicylic acid stimulus|GO:0009751|16463103|IEP go_process response to jasmonic acid stimulus|GO:0009753|16463103|IEP go_process regulation of circadian rhythm|GO:0042752|12007421|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process response to cadmium ion|GO:0046686|16463103|IEP go_process long-day photoperiodism, flowering|GO:0048574|19011118|IGI go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|9657154|ISS product Homeodomain-like superfamily protein note LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1); Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2; Bacteria - 257; Metazoa - 292; Fungi - 162; Plants - 1048; Viruses - 29; Other Eukaryotes - 679 (source: NCBI BLink). protein_id AT1G01060.2p transcript_id AT1G01060.2 protein_id AT1G01060.2p transcript_id AT1G01060.2 LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS At1g01060[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01060.3 CDS gene_syn LATE ELONGATED HYPOCOTYL, LATE ELONGATED HYPOCOTYL 1, LHY, LHY1, T25K16.6, T25K16_6 gene LHY function LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 go_process response to salt stress|GO:0009651|16463103|IEP go_process response to ethylene stimulus|GO:0009723|16463103|IEP go_process response to auxin stimulus|GO:0009733|16463103|IEP go_process response to abscisic acid stimulus|GO:0009737|16463103|IEP go_process response to gibberellin stimulus|GO:0009739|16463103|IEP go_process response to salicylic acid stimulus|GO:0009751|16463103|IEP go_process response to jasmonic acid stimulus|GO:0009753|16463103|IEP go_process regulation of circadian rhythm|GO:0042752|12007421|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process response to cadmium ion|GO:0046686|16463103|IEP go_process long-day photoperiodism, flowering|GO:0048574|19011118|IGI go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|9657154|ISS product Homeodomain-like superfamily protein note LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01060.3p transcript_id AT1G01060.3 protein_id AT1G01060.3p transcript_id AT1G01060.3 LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS At1g01060[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01060.4 CDS gene_syn LATE ELONGATED HYPOCOTYL, LATE ELONGATED HYPOCOTYL 1, LHY, LHY1, T25K16.6, T25K16_6 gene LHY function LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 go_process response to salt stress|GO:0009651|16463103|IEP go_process response to ethylene stimulus|GO:0009723|16463103|IEP go_process response to auxin stimulus|GO:0009733|16463103|IEP go_process response to abscisic acid stimulus|GO:0009737|16463103|IEP go_process response to gibberellin stimulus|GO:0009739|16463103|IEP go_process response to salicylic acid stimulus|GO:0009751|16463103|IEP go_process response to jasmonic acid stimulus|GO:0009753|16463103|IEP go_process regulation of circadian rhythm|GO:0042752|12007421|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process response to cadmium ion|GO:0046686|16463103|IEP go_process long-day photoperiodism, flowering|GO:0048574|19011118|IGI go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|9657154|ISS product Homeodomain-like superfamily protein note LATE ELONGATED HYPOCOTYL (LHY); CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), Myb-like DNA-binding domain, SHAQKYF class (InterPro:IPR006447), HTH transcriptional regulator, Myb-type, DNA-binding (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1); Has 2567 Blast hits to 2041 proteins in 275 species: Archae - 2; Bacteria - 252; Metazoa - 294; Fungi - 166; Plants - 1044; Viruses - 30; Other Eukaryotes - 779 (source: NCBI BLink). protein_id AT1G01060.4p transcript_id AT1G01060.4 protein_id AT1G01060.4p transcript_id AT1G01060.4 LOCN 300-UTR3 COOR C/33992-34327,34401-35471,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS At1g01060[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01060.5 CDS gene_syn LATE ELONGATED HYPOCOTYL, LATE ELONGATED HYPOCOTYL 1, LHY, LHY1, T25K16.6, T25K16_6 gene LHY function LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 go_process response to salt stress|GO:0009651|16463103|IEP go_process response to ethylene stimulus|GO:0009723|16463103|IEP go_process response to auxin stimulus|GO:0009733|16463103|IEP go_process response to abscisic acid stimulus|GO:0009737|16463103|IEP go_process response to gibberellin stimulus|GO:0009739|16463103|IEP go_process response to salicylic acid stimulus|GO:0009751|16463103|IEP go_process response to jasmonic acid stimulus|GO:0009753|16463103|IEP go_process regulation of circadian rhythm|GO:0042752|12007421|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process response to cadmium ion|GO:0046686|16463103|IEP go_process long-day photoperiodism, flowering|GO:0048574|19011118|IGI go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|9657154|ISS product Homeodomain-like superfamily protein note LATE ELONGATED HYPOCOTYL (LHY); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: in 11 processes; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1). protein_id AT1G01060.5p transcript_id AT1G01060.5 protein_id AT1G01060.5p transcript_id AT1G01060.5 LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35999,36090-36171,36624-36685,36810-36836