CLON SALKseq_132342.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/33354-33354 NOTE KO407333 Salk 60K 1:33263 CTATGTAGGATACTTGCATTACATTTTTCACAAATAATTTGGTTTGGTAGCAAATTGACGCTTAGACAACTTAATGTTA HITS AT1G01050.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.1 CDS ID=AT1G01050.1; Parent=AT1G01050; Name=AT1G01050.1; Note=pyrophosphorylase 1; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; conf_class=2; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; locus_type=protein_coding LOCN 1000-Promotor COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 HITS AT1G01050.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.2 CDS ID=AT1G01050.2; Parent=AT1G01050; Name=AT1G01050.2; Note=pyrophosphorylase 1; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; locus_type=protein_coding LOCN 1000-Promotor COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670