CLON SALKseq_132342.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/33354-33354 NOTE KO407333 Salk 60K 1:33263 CTATGTAGGATACTTGCATTACATTTTTCACAAATAATTTGGTTTGGTAGCAAATTGACGCTTAGACAACTTAATGTTA HITS At1g01050[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01050.1 CDS gene_syn AtPPa1, PPa1, T25K16.5, T25K16_5, pyrophosphorylase 1 gene PPa1 function Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. go_process phosphate metabolic process|GO:0006796||IEA go_component nucleus|GO:0005634|15610358|IDA go_component cytoplasm|GO:0005737|15610358|IDA go_component membrane|GO:0016020||ISS go_process metabolic process|GO:0008152||ISS go_function inorganic diphosphatase activity|GO:0004427||IDA product pyrophosphorylase 1 note pyrophosphorylase 1 (PPa1); FUNCTIONS IN: inorganic diphosphatase activity; INVOLVED IN: phosphate metabolic process, metabolic process; LOCATED IN: nucleus, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162); BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1); Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172; Bacteria - 4313; Metazoa - 247; Fungi - 261; Plants - 270; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink). protein_id AT1G01050.1p transcript_id AT1G01050.1 protein_id AT1G01050.1p transcript_id AT1G01050.1 LOCN 1000-Promotor COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670