CLON SALKseq_107475.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/31364-31364 NOTE KO436371 Salk 20K 1:31363 CTCCACACCCTGAGGCGTTGAAGCTTCTCCTCAGAAGATCATGACACATTAATAACACAAATTGACGCTTAGACAACTT HITS AT1G01040.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.1 CDS ID=AT1G01040.1; Parent=AT1G01040; Name=AT1G01040.1; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN 300-UTR3 COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS AT1G01040.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.2 CDS ID=AT1G01040.2; Parent=AT1G01040; Name=AT1G01040.2; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN 300-UTR3 COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27536,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS AT1G01050.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.1 CDS ID=AT1G01050.1; Parent=AT1G01050; Name=AT1G01050.1; Note=pyrophosphorylase 1; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; conf_class=2; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; locus_type=protein_coding LOCN 300-UTR3 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 HITS AT1G01050.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.2 CDS ID=AT1G01050.2; Parent=AT1G01050; Name=AT1G01050.2; Note=pyrophosphorylase 1; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670