CLON SALKseq_090151.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/8677-8677 NOTE KO425721 Salk 80K 1:8678 CACATCCCACGCATCTGTGTTCACTCGCCGCCATTGCTCTCTCTCATATTGTCTAAGCAATGTGGTGTAAACAAATTG HITS AT1G01020.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.1 CDS ID=AT1G01020.1; Parent=AT1G01020; Name=AT1G01020.1; Note=ARV1 family protein; conf_class=2; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666 HITS AT1G01020.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.3 CDS ID=AT1G01020.3; Parent=AT1G01020; Name=AT1G01020.3; Note=ARV1 family protein; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8442 HITS AT1G01020.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.4 CDS ID=AT1G01020.4; Parent=AT1G01020; Name=AT1G01020.4; Note=ARV1 family protein; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8442 HITS AT1G01020.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.5 CDS ID=AT1G01020.5; Parent=AT1G01020; Name=AT1G01020.5; Note=ARV1 family protein; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8419 HITS AT1G01020.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.2 CDS ID=AT1G01020.2; Parent=AT1G01020; Name=AT1G01020.2; Note=ARV1 family protein; conf_class=2; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/7315-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666 HITS AT1G01020.6[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.6 CDS ID=AT1G01020.6; Parent=AT1G01020; Name=AT1G01020.6; Note=ARV1 family protein; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 300-UTR5 COOR C/7315-7450,7564-7649,8236-8325,8417-8419