CLON SALKseq_075052.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/9556-9556 NOTE KO393291 Salk 70K 1:9534 AACAATAATTGGAGCATGTCATTAATTCTGGTTACAATATTGTGTGTAAATATTACAATAGTTGTGGTGTAAACAAATT HITS AT1G01020.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.1 CDS ID=AT1G01020.1; Parent=AT1G01020; Name=AT1G01020.1; Note=ARV1 family protein; conf_class=2; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 1000-Promotor COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666 HITS AT1G01020.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01020.2 CDS ID=AT1G01020.2; Parent=AT1G01020; Name=AT1G01020.2; Note=ARV1 family protein; conf_class=2; symbol=ARV1; computational_description=ARV1%3B CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290)%3B BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1)%3B Has 311 Blast hits to 311 proteins in 154 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 110%3B Fungi - 115%3B Plants - 42%3B Viruses - 0%3B Other Eukaryotes - 44 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15010618, locus:2200940; locus_type=protein_coding LOCN 1000-Promotor COOR C/7315-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666