CLON SALKseq_075052.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/9556-9556 NOTE KO393291 Salk 70K 1:9534 AACAATAATTGGAGCATGTCATTAATTCTGGTTACAATATTGTGTGTAAATATTACAATAGTTGTGGTGTAAACAAATT HITS At1g01020[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01020.1 CDS gene_syn ARV1, T25K16.2, T25K16_2 gene ARV1 go_component endoplasmic reticulum|GO:0005783|16725371|IDA go_component membrane|GO:0016020||ISS go_process sphingolipid metabolic process|GO:0006665|16725371|IMP go_process sterol metabolic process|GO:0016125|16725371|IMP go_function molecular_function|GO:0003674||ND product Arv1-like protein note ARV1; CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290); BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1); Has 311 Blast hits to 311 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 115; Plants - 42; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink). protein_id AT1G01020.1p transcript_id AT1G01020.1 protein_id AT1G01020.1p transcript_id AT1G01020.1 LOCN 1000-Promotor COOR C/6915-7069,7157-7232,7384-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666 HITS At1g01020[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01020.2 CDS gene_syn ARV1, T25K16.2, T25K16_2 gene ARV1 go_component endoplasmic reticulum|GO:0005783|16725371|IDA go_component membrane|GO:0016020||ISS go_process sphingolipid metabolic process|GO:0006665|16725371|IMP go_process sterol metabolic process|GO:0016125|16725371|IMP go_function molecular_function|GO:0003674||ND product Arv1-like protein note ARV1; CONTAINS InterPro DOMAIN/s: Arv1-like protein (InterPro:IPR007290); BEST Arabidopsis thaliana protein match is: Arv1-like protein (TAIR:AT4G01510.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01020.2p transcript_id AT1G01020.2 protein_id AT1G01020.2p transcript_id AT1G01020.2 LOCN 1000-Promotor COOR C/7315-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666