CLON SALKseq_066122.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/16598-16598 NOTE KO342684 Salk 50K 1:16483 ACATATGGTGAGTATATATATATGTAAGATTTGAATCAAATGGTTAAAGTAGGGGTCAAATTGACGCTTAGACAACTT HITS AT1TE00020[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00020 transposable_element ID=AT1TE00020; Name=AT1TE00020; Alias=ATREP4 LOCN 300-UTR3 COOR C/16883-17009 HITS AT1TE00025[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00025 transposable_element ID=AT1TE00025; Name=AT1TE00025; Alias=ATREP3 LOCN 1000-Promotor COOR W/17024-18330,18643-18924