CLON SALKseq_046278.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/11933-11933 NOTE KO381801 Salk 20K 1:11785 AAATTGAGAGAAAGTGAAGACTTCCCTTTCTTAGCAAATTGATCATCATCGCCATCATCAACAAATTGACGCTTAGACA HITS At1g01030[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01030.1 CDS gene_syn NGA3, NGATHA3, T25K16.3, T25K16_3 gene NGA3 go_component cellular_component|GO:0005575||ND go_process flower development|GO:0009908|16603651|IMP go_process regulation of transcription|GO:0045449|11118137|TAS go_process leaf development|GO:0048366|16603651|IMP go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS product AP2/B3-like transcriptional factor family protein note NGATHA3 (NGA3); CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1); Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1380; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). protein_id AT1G01030.1p transcript_id AT1G01030.1 protein_id AT1G01030.1p transcript_id AT1G01030.1 LOCN Exon COOR C/11864-12940