CLON SALKseq_036290.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/39524-39524 NOTE KO341120 Salk 10K 1:39526 TATGGATGTTGTTTCAAGGGACTTTAAGTATTAAGTACCCTTGCAAATACTCGAGCACATTGCGGTGTAAACAAATTGA HITS At1g01070[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01070.1 CDS gene_syn T25K16.7, T25K16_7 go_component membrane|GO:0016020||IEA product nodulin MtN21 /EamA-like transporter family protein note nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1); Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23; Bacteria - 1686; Metazoa - 4; Fungi - 6; Plants - 1233; Viruses - 0; Other Eukaryotes - 259 (source: NCBI BLink). protein_id AT1G01070.1p transcript_id AT1G01070.1 protein_id AT1G01070.1p transcript_id AT1G01070.1 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 HITS At1g01070[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01070.2 CDS gene_syn T25K16.7, T25K16_7 go_component membrane|GO:0016020||IEA product nodulin MtN21 /EamA-like transporter family protein note nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11450.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01070.2p transcript_id AT1G01070.2 protein_id AT1G01070.2p transcript_id AT1G01070.2 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40597