CLON SAILseq_588_C07.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/19046-19046 NOTE KO325916 SAIL 30K 1:19085 AAAACCAGAGTGTGTATACGAATAAAAGTTGTGTATCACTGAACACACCAAATTTATATCTAGTCAACAATAGCATATATTGTGGTGTAATCAAT HITS AT1TE00025[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00025 transposable_element ID=AT1TE00025; Name=AT1TE00025; Alias=ATREP3 LOCN 300-UTR3 COOR W/17024-18330,18643-18924 HITS AT1TE00030[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00030 transposable_element ID=AT1TE00030; Name=AT1TE00030; Alias=ATHATN7 LOCN 1000-Promotor COOR C/18331-18642