CODE At1g01046 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene CHRO chr1 TITL AT1G01046.1 miRNA gene_syn MIR838A, microRNA838A gene MIR838A function Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of 21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA go_component cellular_component|GO:0005575||ND go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product MIR838A (microRNA838A); miRNA transcript_id AT1G01046.1 COOR W/28500-28706 HITS GATCACTAAAGCATCTC [About MPSS mRNA] TYPE MPSS mRNA Target EVAL 100.00 LOCN 1000-Promotor COOR W/27659-27675 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 HITS ASRP200726 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN 1000-Promotor COOR W/27833-27854 HITS GATCCCATGGTGTCGTG [About MPSS mRNA] TYPE MPSS mRNA Target EVAL 100.00 LOCN 1000-Promotor COOR C/27871-27887 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 HITS CATCCTTCGATGTTGTG [About MPSS sRNA] TYPE MPSS sRNA Contig EVAL 100.00 LOCN 1000-Promotor COOR W/28152-28168 NOTE 1, +0 4 0 0 0 HITS RAFL07-36-P21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.54 LOCN Exon COOR W/28521-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31183 HITS ASRP159401 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN Exon COOR W/28533-28556 HITS ASRP186012 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN Exon COOR W/28634-28655 HITS BU636534 [GenBank] TYPE ESTs EVAL 0.0 LOCN 300-UTR3 COOR W/28909-29076,29158-29714 HITS ASRP87688 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN 300-UTR3 COOR C/28969-28989