CLON AF292940[GenBank] 
TYPE Community cDNA
CHRO chr1
EVAL 99.89
COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31153

HITS At1g01040[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01040.1 CDS gene_syn ABNORMAL SUSPENSOR 1, ASU1, ATDCL1, CAF, CARPEL FACTORY, DCL1, DICER-LIKE 1, EMB60, EMB76, EMBRYO DEFECTIVE 60, EMBRYO DEFECTIVE 76, SHORT INTEGUMENTS 1, SIN1, SUS1, SUSPENSOR 1, T25K16.4, T25K16_4, dicer-like 1 gene DCL1 function Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. go_component nucleus|GO:0005634|15821876|IDA go_component nucleus|GO:0005634|17369351|IDA go_component nuclear dicing body|GO:0010445|17442570|IDA go_process cytokinesis|GO:0000910|10556049|IMP go_process RNA processing|GO:0006396|12225663|ISS go_process virus induced gene silencing|GO:0009616|17090584|IMP go_process embryonic pattern specification|GO:0009880|8787738|IMP go_process flower development|GO:0009908|8787738|TAS go_process suspensor development|GO:0010098||IMP go_process vegetative to reproductive phase transition of meristem|GO:0010228|8787738|IMP go_process production of ta-siRNAs involved in RNA interference|GO:0010267|16699516|IMP go_process production of lsiRNA involved in RNA interference|GO:0010599|18003861|IMP go_process production of siRNA involved in RNA interference|GO:0030422|17558406|IMP go_process primary microRNA processing|GO:0031053|16144699|TAS go_process production of miRNAs involved in gene silencing by miRNA|GO:0035196|16810317|IGI go_process mRNA cleavage involved in gene silencing by miRNA|GO:0035279|15851028|IMP go_function double-stranded RNA binding|GO:0003725|15821876|IDA go_function ribonuclease III activity|GO:0004525||ISS go_function protein binding|GO:0005515|15821876|IPI go_function ATP-dependent helicase activity|GO:0008026||ISS product dicer-like 1 note dicer-like 1 (DCL1); CONTAINS InterPro DOMAIN/s: Restriction endonuclease, type I, R subunit/Type III, Res subunit (InterPro:IPR006935), Double-stranded RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Ribonuclease III (InterPro:IPR000999), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021), Dicer double-stranded RNA-binding fold (InterPro:IPR005034); BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2); Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328; Bacteria - 11461; Metazoa - 3615; Fungi - 1668; Plants - 1373; Viruses - 45; Other Eukaryotes - 3468 (source: NCBI BLink). protein_id AT1G01040.1p transcript_id AT1G01040.1 protein_id AT1G01040.1p transcript_id AT1G01040.1 LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS At1g01040[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01040.2 CDS gene_syn ABNORMAL SUSPENSOR 1, ASU1, ATDCL1, CAF, CARPEL FACTORY, DCL1, DICER-LIKE 1, EMB60, EMB76, EMBRYO DEFECTIVE 60, EMBRYO DEFECTIVE 76, SHORT INTEGUMENTS 1, SIN1, SUS1, SUSPENSOR 1, T25K16.4, T25K16_4, dicer-like 1 gene DCL1 function Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. go_component nucleus|GO:0005634|15821876|IDA go_component nucleus|GO:0005634|17369351|IDA go_component nuclear dicing body|GO:0010445|17442570|IDA go_process cytokinesis|GO:0000910|10556049|IMP go_process RNA processing|GO:0006396|12225663|ISS go_process virus induced gene silencing|GO:0009616|17090584|IMP go_process embryonic pattern specification|GO:0009880|8787738|IMP go_process flower development|GO:0009908|8787738|TAS go_process suspensor development|GO:0010098||IMP go_process vegetative to reproductive phase transition of meristem|GO:0010228|8787738|IMP go_process production of ta-siRNAs involved in RNA interference|GO:0010267|16699516|IMP go_process production of lsiRNA involved in RNA interference|GO:0010599|18003861|IMP go_process production of siRNA involved in RNA interference|GO:0030422|17558406|IMP go_process primary microRNA processing|GO:0031053|16144699|TAS go_process production of miRNAs involved in gene silencing by miRNA|GO:0035196|16810317|IGI go_process mRNA cleavage involved in gene silencing by miRNA|GO:0035279|15851028|IMP go_function double-stranded RNA binding|GO:0003725|15821876|IDA go_function ribonuclease III activity|GO:0004525||ISS go_function protein binding|GO:0005515|15821876|IPI go_function ATP-dependent helicase activity|GO:0008026||ISS product dicer-like 1 note dicer-like 1 (DCL1); CONTAINS InterPro DOMAIN/s: Restriction endonuclease, type I, R subunit/Type III, Res subunit (InterPro:IPR006935), Double-stranded RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein, PAZ (InterPro:IPR003100), Ribonuclease III (InterPro:IPR000999), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Dicer double-stranded RNA-binding fold (InterPro:IPR005034), Helicase, superfamily 1/2, ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.1). protein_id AT1G01040.2p transcript_id AT1G01040.2 protein_id AT1G01040.2p transcript_id AT1G01040.2 LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27536,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS At1g01046[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01046.1 miRNA gene_syn MIR838A, microRNA838A gene MIR838A function Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of 21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA go_component cellular_component|GO:0005575||ND go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product MIR838A (microRNA838A); miRNA transcript_id AT1G01046.1 LOCN Exon COOR W/28500-28706 HITS At1g01050[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01050.1 CDS gene_syn AtPPa1, PPa1, T25K16.5, T25K16_5, pyrophosphorylase 1 gene PPa1 function Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. go_process phosphate metabolic process|GO:0006796||IEA go_component nucleus|GO:0005634|15610358|IDA go_component cytoplasm|GO:0005737|15610358|IDA go_component membrane|GO:0016020||ISS go_process metabolic process|GO:0008152||ISS go_function inorganic diphosphatase activity|GO:0004427||IDA product pyrophosphorylase 1 note pyrophosphorylase 1 (PPa1); FUNCTIONS IN: inorganic diphosphatase activity; INVOLVED IN: phosphate metabolic process, metabolic process; LOCATED IN: nucleus, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162); BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1); Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172; Bacteria - 4313; Metazoa - 247; Fungi - 261; Plants - 270; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink). protein_id AT1G01050.1p transcript_id AT1G01050.1 protein_id AT1G01050.1p transcript_id AT1G01050.1 LOCN 300-UTR3 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670