AtTome: Genome Express Database ( Aug. 2, 2016 )


CLON ES201588[GenBank] 
TYPE ESTs
CHRO chr1
EVAL 2e-34
COOR C/78854-78931

HITS At1g01183[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01183.1 miRNA gene_syn MICRORNA 165, MIR165, MIR165A, microRNA165A gene MIR165A function Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of 21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC go_component cellular_component|GO:0005575||ND go_process gene silencing by miRNA|GO:0035195|15200956|TAS go_function molecular_function|GO:0003674||ND product MIR165A (microRNA165A); miRNA transcript_id AT1G01183.1 LOCN 300-UTR3 COOR C/78932-79032

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2016 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |