AtTome: Genome Express Database ( Aug. 2, 2016 )


CLON JAtY67L08[About JAtY] 
TYPE JAtY TAC
CHRO chr1
EVAL 0.0
COOR C/38255-121639

HITS At1g01070[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01070.1 CDS gene_syn T25K16.7, T25K16_7 go_component membrane|GO:0016020||IEA product nodulin MtN21 /EamA-like transporter family protein note nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1); Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23; Bacteria - 1686; Metazoa - 4; Fungi - 6; Plants - 1233; Viruses - 0; Other Eukaryotes - 259 (source: NCBI BLink). protein_id AT1G01070.1p transcript_id AT1G01070.1 protein_id AT1G01070.1p transcript_id AT1G01070.1 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 HITS At1g01070[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01070.2 CDS gene_syn T25K16.7, T25K16_7 go_component membrane|GO:0016020||IEA product nodulin MtN21 /EamA-like transporter family protein note nodulin MtN21 /EamA-like transporter family protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11450.2); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01070.2p transcript_id AT1G01070.2 protein_id AT1G01070.2p transcript_id AT1G01070.2 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40597 HITS At1g01073[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01073.1 CDS go_component endomembrane system|GO:0012505||IEA go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product unknown protein note unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). protein_id AT1G01073.1p transcript_id AT1G01073.1 protein_id AT1G01073.1p transcript_id AT1G01073.1 LOCN Exon COOR W/44677-44787 HITS At1g01080[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01080.1 CDS gene_syn T25K16.19, T25K16_19 go_component nucleus|GO:0005634|14617066|IDA go_component chloroplast|GO:0009507|15028209|IDA go_component chloroplast|GO:0009507|18431481|IDA go_component chloroplast stroma|GO:0009570|18633119|IDA go_component chloroplast envelope|GO:0009941|12938931|IDA go_function nucleotide binding|GO:0000166||IEA go_function nucleic acid binding|GO:0003676||IEA go_process biological_process|GO:0008150||ND go_function RNA binding|GO:0003723||ISS product RNA-binding (RRM/RBD/RNP motifs) family protein note RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, nucleus, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1); Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819; Bacteria - 303967; Metazoa - 99035; Fungi - 14863; Plants - 31737; Viruses - 35534; Other Eukaryotes - 13112 (source: NCBI BLink). protein_id AT1G01080.1p transcript_id AT1G01080.1 protein_id AT1G01080.1p transcript_id AT1G01080.1 LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46376-46789 HITS At1g01080[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01080.2 CDS gene_syn T25K16.19, T25K16_19 go_component chloroplast|GO:0009507|18431481|IDA go_function nucleotide binding|GO:0000166||IEA go_function nucleic acid binding|GO:0003676||IEA go_process biological_process|GO:0008150||ND go_function RNA binding|GO:0003723||ISS product RNA-binding (RRM/RBD/RNP motifs) family protein note RNA-binding (RRM/RBD/RNP motifs) family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01080.2p transcript_id AT1G01080.2 protein_id AT1G01080.2p transcript_id AT1G01080.2 LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46373-46789 HITS At1g01090[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01090.1 CDS gene_syn PDH-E1 ALPHA, T25K16.8, T25K16_8, pyruvate dehydrogenase E1 alpha gene PDH-E1 ALPHA function pyruvate dehydrogenase E1 alpha subunit go_component chloroplast|GO:0009507|18431481|IDA go_component chloroplast envelope|GO:0009941|12938931|IDA go_process glycolysis|GO:0006096||IEA go_process metabolic process|GO:0008152||IEA go_process oxidation reduction|GO:0055114||IEA go_component plastid|GO:0009536|9393637|ISS go_process metabolic process|GO:0008152||ISS go_function pyruvate dehydrogenase (acetyl-transferring) activity|GO:0004739|9393637|ISS go_function pyruvate dehydrogenase (acetyl-transferring) activity|GO:0004739||ISS product pyruvate dehydrogenase E1 alpha note pyruvate dehydrogenase E1 alpha (PDH-E1 ALPHA); FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity; INVOLVED IN: oxidation reduction, glycolysis, metabolic process; LOCATED IN: chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dehydrogenase, E1 component (InterPro:IPR001017), Pyruvate dehydrogenase (acetyl-transferring) E1 component, alpha subunit, subgroup y (InterPro:IPR017597); BEST Arabidopsis thaliana protein match is: pyruvate dehydrogenase complex E1 alpha subunit (TAIR:AT1G59900.1); Has 10065 Blast hits to 10059 proteins in 1888 species: Archae - 130; Bacteria - 6136; Metazoa - 517; Fungi - 241; Plants - 224; Viruses - 0; Other Eukaryotes - 2817 (source: NCBI BLink). protein_id AT1G01090.1p transcript_id AT1G01090.1 protein_id AT1G01090.1p transcript_id AT1G01090.1 LOCN Exon COOR C/47705-47982,48075-48852,48936-49166 HITS At1g01100[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01100.1 CDS gene_syn T25K16.9, T25K16_9 go_component plasma membrane|GO:0005886|17317660|IDA go_component cytosolic ribosome|GO:0022626|15734919|IDA go_process translational elongation|GO:0006414||IEA go_function structural constituent of ribosome|GO:0003735||IEA go_component nucleus|GO:0005634|18433157|IDA go_component cytosol|GO:0005829|18433157|IDA go_component ribosome|GO:0005840||ISS go_component cytosolic ribosome|GO:0022626|17934214|IDA go_process translational elongation|GO:0006414||ISS go_function structural constituent of ribosome|GO:0003735||ISS product 60S acidic ribosomal protein family note 60S acidic ribosomal protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858; Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). protein_id AT1G01100.1p transcript_id AT1G01100.1 protein_id AT1G01100.1p transcript_id AT1G01100.1 LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS At1g01100[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01100.2 CDS gene_syn T25K16.9, T25K16_9 go_component plasma membrane|GO:0005886|17317660|IDA go_component cytosolic ribosome|GO:0022626|15734919|IDA go_process translational elongation|GO:0006414||IEA go_function structural constituent of ribosome|GO:0003735||IEA go_component nucleus|GO:0005634|18433157|IDA go_component cytosol|GO:0005829|18433157|IDA go_component ribosome|GO:0005840||ISS go_component cytosolic ribosome|GO:0022626|17934214|IDA go_process translational elongation|GO:0006414||ISS go_function structural constituent of ribosome|GO:0003735||ISS product 60S acidic ribosomal protein family note 60S acidic ribosomal protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858; Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). protein_id AT1G01100.2p transcript_id AT1G01100.2 protein_id AT1G01100.2p transcript_id AT1G01100.2 LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS At1g01100[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01100.3 CDS gene_syn T25K16.9, T25K16_9 go_component plasma membrane|GO:0005886|17317660|IDA go_process translational elongation|GO:0006414||IEA go_function structural constituent of ribosome|GO:0003735||IEA go_component nucleus|GO:0005634|18433157|IDA go_component cytosol|GO:0005829|18433157|IDA go_component ribosome|GO:0005840||ISS go_component cytosolic ribosome|GO:0022626|17934214|IDA go_process translational elongation|GO:0006414||ISS go_function structural constituent of ribosome|GO:0003735||ISS product 60S acidic ribosomal protein family note 60S acidic ribosomal protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2); Has 1446 Blast hits to 1446 proteins in 306 species: Archae - 3; Bacteria - 0; Metazoa - 542; Fungi - 379; Plants - 324; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink). protein_id AT1G01100.3p transcript_id AT1G01100.3 protein_id AT1G01100.3p transcript_id AT1G01100.3 LOCN Exon COOR C/50284-50337,50419-50447,50496-50631,50883-50954 HITS At1g01100[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01100.4 CDS gene_syn T25K16.9, T25K16_9 go_component plasma membrane|GO:0005886|17317660|IDA go_process translational elongation|GO:0006414||IEA go_function structural constituent of ribosome|GO:0003735||IEA go_component nucleus|GO:0005634|18433157|IDA go_component cytosol|GO:0005829|18433157|IDA go_component ribosome|GO:0005840||ISS go_component cytosolic ribosome|GO:0022626|17934214|IDA go_process translational elongation|GO:0006414||ISS go_function structural constituent of ribosome|GO:0003735||ISS product 60S acidic ribosomal protein family note 60S acidic ribosomal protein family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2); Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76; Bacteria - 0; Metazoa - 858; Fungi - 474; Plants - 451; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). protein_id AT1G01100.4p transcript_id AT1G01100.4 protein_id AT1G01100.4p transcript_id AT1G01100.4 LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS At1g01110[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01110.2 CDS gene_syn IQ-domain 18, IQD18, T25K16.10, T25K16_10 gene IQD18 go_function molecular_function|GO:0003674||ND product IQ-domain 18 note IQ-domain 18 (IQD18); FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). protein_id AT1G01110.2p transcript_id AT1G01110.2 protein_id AT1G01110.2p transcript_id AT1G01110.2 LOCN Exon COOR W/52239-52346,52434-52730,52938-53183,53484-53624,53703-54494 HITS At1g01110[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01110.1 CDS gene_syn IQ-domain 18, IQD18, T25K16.10, T25K16_10 gene IQD18 go_component mitochondrion|GO:0005739||IEA go_function molecular_function|GO:0003674||ND product IQ-domain 18 note IQ-domain 18 (IQD18); FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1); Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0; Bacteria - 10; Metazoa - 109; Fungi - 16; Plants - 528; Viruses - 4; Other Eukaryotes - 445 (source: NCBI BLink). protein_id AT1G01110.1p transcript_id AT1G01110.1 protein_id AT1G01110.1p transcript_id AT1G01110.1 LOCN Exon COOR W/53022-53183,53484-53624,53703-54494 HITS At1g01115[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01115.1 CDS go_component endomembrane system|GO:0012505||IEA go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product unknown protein note unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). protein_id AT1G01115.1p transcript_id AT1G01115.1 protein_id AT1G01115.1p transcript_id AT1G01115.1 LOCN Exon COOR W/56624-56740 HITS At1g01120[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01120.1 CDS gene_syn 3-ketoacyl-CoA synthase 1, KCS1, T25K16.11, T25K16_11 gene KCS1 function Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. go_component cytosolic ribosome|GO:0022626|15821981|IDA go_component endoplasmic reticulum|GO:0005783|18465198|IDA go_component membrane|GO:0016020|10074711|ISS go_process very long-chain fatty acid metabolic process|GO:0000038|10074711|IDA go_process response to osmotic stress|GO:0006970|18465198|IEP go_process response to cold|GO:0009409|18465198|IEP go_process response to light stimulus|GO:0009416|18465198|IEP go_process wax biosynthetic process|GO:0010025|10074711|IDA go_process wax biosynthetic process|GO:0010025|10074711|IMP go_process fatty acid elongation|GO:0030497|10074711|IDA go_process cuticle development|GO:0042335|10074711|IMP go_function acyltransferase activity|GO:0008415||ISS go_function fatty acid elongase activity|GO:0009922|10074711|IDA product 3-ketoacyl-CoA synthase 1 note 3-ketoacyl-CoA synthase 1 (KCS1); FUNCTIONS IN: fatty acid elongase activity, acyltransferase activity; INVOLVED IN: in 7 processes; LOCATED IN: cytosolic ribosome, endoplasmic reticulum, membrane; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Very-long-chain 3-ketoacyl-CoA synthase (InterPro:IPR012392), 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C-terminal (InterPro:IPR013747), FAE1/Type III polyketide synthase-like protein (InterPro:IPR013601), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: 3-ketoacyl-CoA synthase 11 (TAIR:AT2G26640.1); Has 3961 Blast hits to 3946 proteins in 966 species: Archae - 0; Bacteria - 1388; Metazoa - 0; Fungi - 5; Plants - 2408; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). protein_id AT1G01120.1p transcript_id AT1G01120.1 protein_id AT1G01120.1p transcript_id AT1G01120.1 LOCN Exon COOR C/57392-58978 HITS At1g01130[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01130.1 CDS gene_syn F6F3.33 go_component cellular_component|GO:0005575||ND go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product unknown protein note CONTAINS InterPro DOMAIN/s: CBL-interacting protein kinase (InterPro:IPR020660), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1); Has 176 Blast hits to 176 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 176; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). protein_id AT1G01130.1p transcript_id AT1G01130.1 protein_id AT1G01130.1p transcript_id AT1G01130.1 LOCN Exon COOR C/61905-61949,62050-62124,63557-63811 HITS At1g01140[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01140.1 CDS gene_syn CBL-interacting protein kinase 9, CIPK9, F6F3.28, PKS6, PROTEIN KINASE 6, SNF1-RELATED PROTEIN KINASE 3.12, SnRK3.12 gene CIPK9 function Encodes a CBL-interacting protein kinase with similarity to SOS2 go_function protein kinase activity|GO:0004672||IEA go_function protein serine/threonine kinase activity|GO:0004674||IEA go_function ATP binding|GO:0005524||IEA go_process response to cold|GO:0009409|17486125|IEP go_process response to wounding|GO:0009611|17486125|IEP go_process response to salt stress|GO:0009651|17486125|IEP go_process response to mannitol stimulus|GO:0010555|17486125|IEP go_process regulation of potassium ion transport|GO:0043266|17486125|IMP go_process cellular response to potassium ion starvation|GO:0051365|17486125|IMP go_function kinase activity|GO:0016301||ISS product CBL-interacting protein kinase 9 note CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: in 6 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase domain (InterPro:IPR002290), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), CBL-interacting protein kinase (InterPro:IPR020660), NAF domain (InterPro:IPR004041), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636), Tyrosine-protein kinase, catalytic domain (InterPro:IPR020635); BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1); Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165; Bacteria - 15262; Metazoa - 47961; Fungi - 13206; Plants - 31482; Viruses - 522; Other Eukaryotes - 21605 (source: NCBI BLink). protein_id AT1G01140.1p transcript_id AT1G01140.1 protein_id AT1G01140.1p transcript_id AT1G01140.1 LOCN Exon COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS At1g01140[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01140.2 CDS gene_syn CBL-interacting protein kinase 9, CIPK9, F6F3.28, PKS6, PROTEIN KINASE 6, SNF1-RELATED PROTEIN KINASE 3.12, SnRK3.12 gene CIPK9 function Encodes a CBL-interacting protein kinase with similarity to SOS2 go_function protein kinase activity|GO:0004672||IEA go_function protein serine/threonine kinase activity|GO:0004674||IEA go_function ATP binding|GO:0005524||IEA go_process response to cold|GO:0009409|17486125|IEP go_process response to wounding|GO:0009611|17486125|IEP go_process response to salt stress|GO:0009651|17486125|IEP go_process response to mannitol stimulus|GO:0010555|17486125|IEP go_process regulation of potassium ion transport|GO:0043266|17486125|IMP go_process cellular response to potassium ion starvation|GO:0051365|17486125|IMP go_function kinase activity|GO:0016301||ISS product CBL-interacting protein kinase 9 note CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: in 6 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), NAF domain (InterPro:IPR004041), CBL-interacting protein kinase (InterPro:IPR020660), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1); Has 130491 Blast hits to 128500 proteins in 4421 species: Archae - 165; Bacteria - 15543; Metazoa - 48035; Fungi - 13165; Plants - 31462; Viruses - 522; Other Eukaryotes - 21599 (source: NCBI BLink). protein_id AT1G01140.2p transcript_id AT1G01140.2 protein_id AT1G01140.2p transcript_id AT1G01140.2 LOCN Exon COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65733-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS At1g01140[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01140.3 CDS gene_syn CBL-interacting protein kinase 9, CIPK9, F6F3.28, PKS6, PROTEIN KINASE 6, SNF1-RELATED PROTEIN KINASE 3.12, SnRK3.12 gene CIPK9 function Encodes a CBL-interacting protein kinase with similarity to SOS2 go_function protein kinase activity|GO:0004672||IEA go_function protein serine/threonine kinase activity|GO:0004674||IEA go_function ATP binding|GO:0005524||IEA go_process response to cold|GO:0009409|17486125|IEP go_process response to wounding|GO:0009611|17486125|IEP go_process response to salt stress|GO:0009651|17486125|IEP go_process response to mannitol stimulus|GO:0010555|17486125|IEP go_process regulation of potassium ion transport|GO:0043266|17486125|IMP go_process cellular response to potassium ion starvation|GO:0051365|17486125|IMP go_function kinase activity|GO:0016301||ISS product CBL-interacting protein kinase 9 note CBL-interacting protein kinase 9 (CIPK9); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: in 6 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine-protein kinase domain (InterPro:IPR002290), NAF/FISL domain (InterPro:IPR018451), Serine/threonine-protein kinase-like domain (InterPro:IPR017442), Protein kinase-like domain (InterPro:IPR011009), Serine/threonine-protein kinase, active site (InterPro:IPR008271), NAF domain (InterPro:IPR004041), CBL-interacting protein kinase (InterPro:IPR020660), Protein kinase, catalytic domain (InterPro:IPR000719), Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1); Has 130572 Blast hits to 128490 proteins in 4426 species: Archae - 165; Bacteria - 15544; Metazoa - 48044; Fungi - 13206; Plants - 31490; Viruses - 522; Other Eukaryotes - 21601 (source: NCBI BLink). protein_id AT1G01140.3p transcript_id AT1G01140.3 protein_id AT1G01140.3p transcript_id AT1G01140.3 LOCN Exon COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS At1g01150[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01150.1 CDS gene_syn F6F3.30 go_process regulation of transcription|GO:0045449||IEA go_function DNA binding|GO:0003677||IEA go_function zinc ion binding|GO:0008270||IEA product Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain note Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Zinc finger, PHD-type, conserved site (InterPro:IPR019786), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Homeodomain-related (InterPro:IPR012287), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1); Has 94 Blast hits to 77 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). protein_id AT1G01150.1p transcript_id AT1G01150.1 protein_id AT1G01150.1p transcript_id AT1G01150.1 LOCN Exon COOR C/70115-70285,70840-70968,71041-71721,71942-71998 HITS At1g01160[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01160.1 CDS gene_syn F6F3.29, GIF2, GRF1-interacting factor 2 gene GIF2 function Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA go_component nucleus|GO:0005634|15326298|ISS go_process cell proliferation|GO:0008283|19648231|IEP go_process leaf development|GO:0048366|19648231|IMP go_function transcription coactivator activity|GO:0003713|12974814|ISS go_function protein binding|GO:0005515|15326298|IPI product GRF1-interacting factor 2 note GRF1-interacting factor 2 (GIF2); CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726); BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1); Has 425 Blast hits to 425 proteins in 91 species: Archae - 0; Bacteria - 4; Metazoa - 291; Fungi - 20; Plants - 89; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). protein_id AT1G01160.1p transcript_id AT1G01160.1 protein_id AT1G01160.1p transcript_id AT1G01160.1 LOCN Exon COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 HITS At1g01160[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01160.2 CDS gene_syn F6F3.29, GIF2, GRF1-interacting factor 2 gene GIF2 function Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA go_component nucleus|GO:0005634|15326298|ISS go_process cell proliferation|GO:0008283|19648231|IEP go_process leaf development|GO:0048366|19648231|IMP go_function transcription coactivator activity|GO:0003713|12974814|ISS go_function protein binding|GO:0005515|15326298|IPI product GRF1-interacting factor 2 note GRF1-interacting factor 2 (GIF2); FUNCTIONS IN: protein binding, transcription coactivator activity; INVOLVED IN: cell proliferation, leaf development; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726); BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1); Has 35 Blast hits to 35 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). protein_id AT1G01160.2p transcript_id AT1G01160.2 protein_id AT1G01160.2p transcript_id AT1G01160.2 LOCN Exon COOR W/72583-72669,72915-73016,73087-73163,73287-73395,73488-73740,73822-73883 HITS At1g01170[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01170.1 CDS gene_syn F6F3.32 go_component mitochondrion|GO:0005739|15276431|IDA go_component membrane|GO:0016020|17432890|IDA go_process response to stress|GO:0006950||ISS go_function molecular_function|GO:0003674||ND product Protein of unknown function (DUF1138) note Protein of unknown function (DUF1138); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1); Has 86 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). protein_id AT1G01170.1p transcript_id AT1G01170.1 protein_id AT1G01170.1p transcript_id AT1G01170.1 LOCN Exon COOR C/74105-74250,74338-74443 HITS At1g01170[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01170.2 CDS gene_syn F6F3.32 go_component membrane|GO:0016020|17432890|IDA go_process response to stress|GO:0006950||ISS go_function molecular_function|GO:0003674||ND product Protein of unknown function (DUF1138) note Protein of unknown function (DUF1138); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01170.2p transcript_id AT1G01170.2 protein_id AT1G01170.2p transcript_id AT1G01170.2 LOCN Exon COOR C/74105-74250,74338-74443 HITS At1g01180[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01180.1 CDS gene_syn F6F3.5 go_process lipid biosynthetic process|GO:0008610||IEA go_function methyltransferase activity|GO:0008168||IEA product S-adenosyl-L-methionine-dependent methyltransferases superfamily protein note S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: lipid biosynthetic process; EXPRESSED IN: sperm cell, hypocotyl; CONTAINS InterPro DOMAIN/s: Rhamnosyl O-methyltransferase/Cephalosporin hydroxylase (InterPro:IPR007072); Has 274 Blast hits to 274 proteins in 51 species: Archae - 0; Bacteria - 75; Metazoa - 2; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). protein_id AT1G01180.1p transcript_id AT1G01180.1 protein_id AT1G01180.1p transcript_id AT1G01180.1 LOCN Exon COOR W/75633-76556 HITS At1g01183[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01183.1 miRNA gene_syn MICRORNA 165, MIR165, MIR165A, microRNA165A gene MIR165A function Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of 21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC go_component cellular_component|GO:0005575||ND go_process gene silencing by miRNA|GO:0035195|15200956|TAS go_function molecular_function|GO:0003674||ND product MIR165A (microRNA165A); miRNA transcript_id AT1G01183.1 LOCN Exon COOR C/78932-79032 HITS At1g01190[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01190.1 CDS gene_syn cytochrome P450, family 78, subfamily A, polypeptide 8, CYP78A8, F6F3.25 gene CYP78A8 function member of CYP78A go_component endomembrane system|GO:0012505||IEA go_process oxidation reduction|GO:0055114||IEA go_function monooxygenase activity|GO:0004497||IEA go_function iron ion binding|GO:0005506||IEA go_function electron carrier activity|GO:0009055||IEA go_function heme binding|GO:0020037||IEA go_function oxygen binding|GO:0019825||ISS product cytochrome P450, family 78, subfamily A, polypeptide 8 note cytochrome P450, family 78, subfamily A, polypeptide 8 (CYP78A8); FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; INVOLVED IN: oxidation reduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.10 ten leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); BEST Arabidopsis thaliana protein match is: cytochrome P450, family 78, subfamily A, polypeptide 6 (TAIR:AT2G46660.1); Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48; Bacteria - 3617; Metazoa - 11430; Fungi - 6777; Plants - 9112; Viruses - 3; Other Eukaryotes - 1117 (source: NCBI BLink). protein_id AT1G01190.1p transcript_id AT1G01190.1 protein_id AT1G01190.1p transcript_id AT1G01190.1 LOCN Exon COOR C/83045-83671,83884-84864 HITS At1g01200[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01200.1 CDS gene_syn ARABIDOPSIS RAB GTPASE HOMOLOG A3, ATRAB-A3, ATRABA3, F6F3.1, F6F3_1, RAB GTPase homolog A3, RABA3 gene RABA3 go_component nucleus|GO:0005634|14617066|IDA go_process small GTPase mediated signal transduction|GO:0007264||IEA go_process protein transport|GO:0015031||IEA go_function GTP binding|GO:0005525||IEA go_component endosome|GO:0005768|18239134|IDA go_component cell plate|GO:0009504|18239134|IDA go_function GTP binding|GO:0005525||ISS product RAB GTPase homolog A3 note RAB GTPase homolog A3 (RABA3); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, nucleus, cell plate; EXPRESSED IN: lateral root cap, hypocotyl, root, flower, epidermis; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Small GTPase (InterPro:IPR020851), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1); Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19; Bacteria - 134; Metazoa - 14292; Fungi - 3779; Plants - 3194; Viruses - 20; Other Eukaryotes - 5726 (source: NCBI BLink). protein_id AT1G01200.1p transcript_id AT1G01200.1 protein_id AT1G01200.1p transcript_id AT1G01200.1 LOCN Exon COOR C/86715-87162,87880-88145 HITS At1g01210[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01210.1 CDS gene_syn F6F3.2, F6F3_2 go_process transcription|GO:0006350||IEA go_process regulation of transcription|GO:0045449||IEA go_function nucleic acid binding|GO:0003676||IEA go_function DNA binding|GO:0003677||IEA go_function sequence-specific DNA binding transcription factor activity|GO:0003700||IEA go_function DNA-directed RNA polymerase activity|GO:0003899||IEA go_function zinc ion binding|GO:0008270||IEA go_function transcription regulator activity|GO:0030528||IEA go_component nucleus|GO:0005634||ISS go_process RNA elongation|GO:0006354||ISS go_process regulation of transcription, DNA-dependent|GO:0006355||ISS go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700||ISS go_function DNA-directed RNA polymerase activity|GO:0003899||ISS product DNA-directed RNA polymerase, subunit M, archaeal note DNA-directed RNA polymerase, subunit M, archaeal; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15kDa subunit (InterPro:IPR001529), DNA-directed RNA polymerase, subunit M, archaeal (InterPro:IPR006288), DNA-directed RNA polymerase M, 15kDa subunit, conserved site (InterPro:IPR019761); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, subunit M, archaeal (TAIR:AT4G07950.1); Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242; Bacteria - 0; Metazoa - 276; Fungi - 294; Plants - 112; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). protein_id AT1G01210.1p transcript_id AT1G01210.1 protein_id AT1G01210.1p transcript_id AT1G01210.1 LOCN Exon COOR W/88977-89081,89173-89263,89405-89529 HITS At1g01220[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01220.1 CDS gene_syn Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase, AtFKGP, F6F3.3, F6F3_3, FKGP, L-fucokinase/GDP-L-fucose pyrophosphorylase gene FKGP function Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. go_component cytoplasm|GO:0005737||IEA go_process GDP-L-fucose salvage|GO:0042352|18199744|IDA go_function galactokinase activity|GO:0004335||ISS go_function ATP binding|GO:0005524||ISS go_function fucose-1-phosphate guanylyltransferase activity|GO:0047341|18199744|IDA go_function fucokinase activity|GO:0050201|18199744|IDA product L-fucokinase/GDP-L-fucose pyrophosphorylase note L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP); FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity, fucokinase activity, ATP binding, galactokinase activity; INVOLVED IN: GDP-L-fucose salvage; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206), Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568), GHMP kinase (InterPro:IPR006204), L-fucokinase (InterPro:IPR012887), Ribosomal protein S5 domain 2-type fold, subgroup (InterPro:IPR014721), GHMP kinase, C-terminal (InterPro:IPR013750); Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59; Bacteria - 918; Metazoa - 155; Fungi - 3; Plants - 87; Viruses - 3; Other Eukaryotes - 653 (source: NCBI BLink). protein_id AT1G01220.1p transcript_id AT1G01220.1 protein_id AT1G01220.1p transcript_id AT1G01220.1 LOCN Exon COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS At1g01225[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01225.1 CDS go_component cellular_component|GO:0005575||ND product NC domain-containing protein-related note NC domain-containing protein-related; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein-related (TAIR:AT4G00905.1); Has 173 Blast hits to 172 proteins in 34 species: Archae - 0; Bacteria - 24; Metazoa - 5; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). protein_id AT1G01225.1p transcript_id AT1G01225.1 protein_id AT1G01225.1p transcript_id AT1G01225.1 LOCN Exon COOR W/96064-96157,96554-97242 HITS At1g01230[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01230.1 CDS gene_syn F6F3.4, F6F3_4 go_component integral to membrane|GO:0016021||IEA go_component endoplasmic reticulum|GO:0005783||ISS go_process protein folding|GO:0006457||ISS go_function molecular_function|GO:0003674||ND product ORMDL family protein note ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT5G42000.1); Has 538 Blast hits to 538 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 276; Fungi - 148; Plants - 90; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). protein_id AT1G01230.1p transcript_id AT1G01230.1 protein_id AT1G01230.1p transcript_id AT1G01230.1 LOCN Exon COOR W/97620-97805,98457-98605,98908-99046 HITS At1g01240[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01240.1 CDS gene_syn F633.5, F633_5, F6F3.27 go_process N-terminal protein myristoylation|GO:0006499|12912986|IEA product unknown protein note unknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 95 Blast hits to 78 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 80; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). protein_id AT1G01240.1p transcript_id AT1G01240.1 protein_id AT1G01240.1p transcript_id AT1G01240.1 LOCN Exon COOR W/100683-101678 HITS At1g01240[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01240.2 CDS gene_syn F633.5, F633_5, F6F3.27 product unknown protein note unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01240.2p transcript_id AT1G01240.2 protein_id AT1G01240.2p transcript_id AT1G01240.2 LOCN Exon COOR W/100683-101678 HITS At1g01240[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01240.3 CDS gene_syn F633.5, F633_5, F6F3.27 product unknown protein note unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). protein_id AT1G01240.3p transcript_id AT1G01240.3 protein_id AT1G01240.3p transcript_id AT1G01240.3 LOCN Exon COOR W/100683-101678 HITS At1g01250[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01250.1 CDS gene_syn F6F3.6, F6F3_6 function encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. go_component chloroplast|GO:0009507||IEA go_process regulation of transcription, DNA-dependent|GO:0006355||IEA go_component nucleus|GO:0005634||ISS go_process regulation of transcription, DNA-dependent|GO:0006355||ISS go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700||ISS product Integrase-type DNA-binding superfamily protein note Integrase-type DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor/ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: Integrase-type DNA-binding superfamily protein (TAIR:AT5G25810.1); Has 5404 Blast hits to 5361 proteins in 232 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5399; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). protein_id AT1G01250.1p transcript_id AT1G01250.1 protein_id AT1G01250.1p transcript_id AT1G01250.1 LOCN Exon COOR C/104731-105309 HITS At1g01260[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01260.1 CDS gene_syn F6F3.7, F6F3_7 go_component nucleus|GO:0005634||IEA go_process regulation of transcription|GO:0045449|11118137|TAS go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|12679534|ISS product basic helix-loop-helix (bHLH) DNA-binding superfamily protein note basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1); Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 174; Fungi - 93; Plants - 3336; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). protein_id AT1G01260.1p transcript_id AT1G01260.1 protein_id AT1G01260.1p transcript_id AT1G01260.1 LOCN Exon COOR W/109595-111367 HITS At1g01260[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01260.2 CDS gene_syn F6F3.7, F6F3_7 go_component nucleus|GO:0005634||IEA go_process regulation of transcription|GO:0045449|11118137|TAS go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|12679534|ISS product basic helix-loop-helix (bHLH) DNA-binding superfamily protein note basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1); Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0; Bacteria - 2; Metazoa - 174; Fungi - 93; Plants - 3336; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). protein_id AT1G01260.2p transcript_id AT1G01260.2 protein_id AT1G01260.2p transcript_id AT1G01260.2 LOCN Exon COOR W/109595-111367 HITS At1g01260[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01260.3 CDS gene_syn F6F3.7, F6F3_7 go_component nucleus|GO:0005634||IEA go_process regulation of transcription|GO:0045449|11118137|TAS go_function DNA binding|GO:0003677||ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|11118137|ISS go_function sequence-specific DNA binding transcription factor activity|GO:0003700|12679534|ISS product basic helix-loop-helix (bHLH) DNA-binding superfamily protein note basic helix-loop-helix (bHLH) DNA-binding superfamily protein; FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1). protein_id AT1G01260.3p transcript_id AT1G01260.3 protein_id AT1G01260.3p transcript_id AT1G01260.3 LOCN Exon COOR W/109595-111367 HITS At1g01270[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01270.1 tRNA gene_syn 51947.TRNA-GLN-1 go_component cellular_component|GO:0005575||ND go_process translational elongation|GO:0006414|8980477|TAS go_function triplet codon-amino acid adaptor activity|GO:0030533|8980477|TAS product pre-tRNA note tRNA-Gln (anticodon: CTG) transcript_id AT1G01270.1 LOCN Exon COOR C/111890-111961 HITS At1g01280[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01280.1 CDS gene_syn cytochrome P450, family 703, subfamily A, polypeptide 2, CYP703, CYP703A2, F6F3.8, F6F3_8 gene CYP703A2 function member of CYP703A CYP703A2 is expressed specifically in anthers of land plants, catalyzing the in-chain hydroxylation at the C-7 position of medium-chain saturated fatty acids (lauric acid in-chain hydroxylase) which is involved in pollen development (sporopollenin synthesis). go_component endomembrane system|GO:0012505||IEA go_process pollen wall assembly|GO:0010208|17496121|IMP go_process pollen exine formation|GO:0010584||IMP go_process medium-chain fatty acid metabolic process|GO:0051791|17496121|IDA go_process medium-chain fatty acid biosynthetic process|GO:0051792|17496121|IDA go_process sporopollenin biosynthetic process|GO:0080110|17496121|IMP go_process sporopollenin biosynthetic process|GO:0080110|17496121|TAS go_function oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|GO:0016709|17496121|IDA go_function oxygen binding|GO:0019825||ISS product cytochrome P450, family 703, subfamily A, polypeptide 2 note cytochrome P450, family 703, subfamily A, polypeptide 2 (CYP703A2); FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen, oxygen binding; INVOLVED IN: medium-chain fatty acid metabolic process, pollen wall assembly, medium-chain fatty acid biosynthetic process, sporopollenin biosynthetic process, pollen exine formation; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); BEST Arabidopsis thaliana protein match is: Cytochrome P450 superfamily protein (TAIR:AT5G07990.1); Has 29652 Blast hits to 29399 proteins in 1569 species: Archae - 44; Bacteria - 2451; Metazoa - 11172; Fungi - 6019; Plants - 9091; Viruses - 3; Other Eukaryotes - 872 (source: NCBI BLink). protein_id AT1G01280.1p transcript_id AT1G01280.1 protein_id AT1G01280.1p transcript_id AT1G01280.1 LOCN Exon COOR W/112290-113195,113279-113905 HITS At1g01290[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01290.1 CDS gene_syn CNX3, F6F3.9, F6F3_9, cofactor of nitrate reductase and xanthine dehydrogenase 3 gene CNX3 function COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria go_component mitochondrion|GO:0005739|7890743|ISS go_component chloroplast|GO:0009507|7890743|ISS go_process Mo-molybdopterin cofactor biosynthetic process|GO:0006777|7890743|IGI go_function catalytic activity|GO:0003824|7890743|IGI product cofactor of nitrate reductase and xanthine dehydrogenase 3 note cofactor of nitrate reductase and xanthine dehydrogenase 3 (CNX3); CONTAINS InterPro DOMAIN/s: Molybdopterin cofactor biosynthesis C (MoaC) domain (InterPro:IPR002820); Has 5242 Blast hits to 5240 proteins in 1916 species: Archae - 213; Bacteria - 3669; Metazoa - 104; Fungi - 75; Plants - 45; Viruses - 0; Other Eukaryotes - 1136 (source: NCBI BLink). protein_id AT1G01290.1p transcript_id AT1G01290.1 protein_id AT1G01290.1p transcript_id AT1G01290.1 LOCN Exon COOR W/114299-114433,114619-115296 HITS At1g01290[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01290.2 CDS gene_syn CNX3, F6F3.9, F6F3_9, cofactor of nitrate reductase and xanthine dehydrogenase 3 gene CNX3 function COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined, except in roots. Appears to have targeting signals for chloroplast or mitochondria go_component mitochondrion|GO:0005739|7890743|ISS go_component chloroplast|GO:0009507|7890743|ISS go_process Mo-molybdopterin cofactor biosynthetic process|GO:0006777|7890743|IGI go_function catalytic activity|GO:0003824|7890743|IGI product cofactor of nitrate reductase and xanthine dehydrogenase 3 note cofactor of nitrate reductase and xanthine dehydrogenase 3 (CNX3); CONTAINS InterPro DOMAIN/s: Molybdopterin cofactor biosynthesis C (MoaC) domain (InterPro:IPR002820); Has 5242 Blast hits to 5240 proteins in 1916 species: Archae - 213; Bacteria - 3669; Metazoa - 104; Fungi - 75; Plants - 45; Viruses - 0; Other Eukaryotes - 1136 (source: NCBI BLink). protein_id AT1G01290.2p transcript_id AT1G01290.2 protein_id AT1G01290.2p transcript_id AT1G01290.2 LOCN Exon COOR W/114299-114433,114619-115296 HITS At1g01300[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01300.1 CDS gene_syn F6F3.10, F6F3_10 go_component membrane|GO:0016020|17432890|IDA go_function aspartic-type endopeptidase activity|GO:0004190||IEA go_component plant-type cell wall|GO:0009505|16287169|IDA go_process proteolysis|GO:0006508||ISS go_process response to karrikin|GO:0080167|20351290|IEP product Eukaryotic aspartyl protease family protein note Eukaryotic aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, response to karrikin; LOCATED IN: membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109), Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: Eukaryotic aspartyl protease family protein (TAIR:AT3G61820.1); Has 3898 Blast hits to 3871 proteins in 332 species: Archae - 0; Bacteria - 0; Metazoa - 1165; Fungi - 579; Plants - 1953; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). protein_id AT1G01300.1p transcript_id AT1G01300.1 protein_id AT1G01300.1p transcript_id AT1G01300.1 LOCN Exon COOR W/117065-118522 HITS At1g01305[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01305.1 CDS go_component endomembrane system|GO:0012505||IEA go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product unknown protein note unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). protein_id AT1G01305.1p transcript_id AT1G01305.1 protein_id AT1G01305.1p transcript_id AT1G01305.1 LOCN Exon COOR W/119429-119854 HITS At1g01310[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01310.1 CDS gene_syn F6F3.11, F6F3_11 go_component extracellular region|GO:0005576||IEA go_component extracellular region|GO:0005576||ISS go_process biological_process|GO:0008150||ND go_function molecular_function|GO:0003674||ND product CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein note CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related, conserved site (InterPro:IPR018244), Allergen V5/Tpx-1 related (InterPro:IPR001283), Ves allergen (InterPro:IPR002413), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein (TAIR:AT3G09590.1); Has 2987 Blast hits to 2892 proteins in 368 species: Archae - 0; Bacteria - 64; Metazoa - 1591; Fungi - 333; Plants - 892; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). protein_id AT1G01310.1p transcript_id AT1G01310.1 protein_id AT1G01310.1p transcript_id AT1G01310.1 LOCN Exon COOR W/120221-120946 HITS At1g01320[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01320.1 CDS gene_syn F6F3.12, F6F3_12 go_function binding|GO:0005488||IEA go_component cellular_component|GO:0005575||ND product Tetratricopeptide repeat (TPR)-like superfamily protein note Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G28080.1); Has 12123 Blast hits to 4846 proteins in 494 species: Archae - 106; Bacteria - 3214; Metazoa - 4973; Fungi - 1823; Plants - 555; Viruses - 79; Other Eukaryotes - 1373 (source: NCBI BLink). protein_id AT1G01320.1p transcript_id AT1G01320.1 protein_id AT1G01320.1p transcript_id AT1G01320.1 LOCN Exon COOR C/121582-123501,123579-123669,123785-123897,123992-124123,124211-124394,124499-124632,124714-124818,124921-125046,125134-125226,125329-125655,125742-125843,125936-125998,126076-126589,126686-126840,126935-127453,127532-127573,127651-127782,127868-127935,128028-128312,128479-128551,128968-129060,129853-129914,130039-130099 HITS At1g01320[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Phosphat] [Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G01320.2 CDS gene_syn F6F3.12, F6F3_12 go_function binding|GO:0005488||IEA go_component cellular_component|GO:0005575||ND product Tetratricopeptide repeat (TPR)-like superfamily protein note Tetratricopeptide repeat (TPR)-like superfamily protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide repeat-containing (InterPro:IPR013026), Tetratricopeptide repeat (InterPro:IPR019734); BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G28080.1). protein_id AT1G01320.2p transcript_id AT1G01320.2 protein_id AT1G01320.2p transcript_id AT1G01320.2 LOCN Exon COOR C/121582-123495,123579-123669,123785-123897,123992-124123,124211-124394,124499-124632,124714-124818,124921-125022,125134-125226,125329-125655,125742-125843,125936-125998,126076-126589,126686-126840,126935-127453,127532-127573,127651-127782,127868-127935,128028-128312,128479-128551,128968-129060,129853-129914,130039-130099

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2016 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |