RiceGE: Genome Express Database ( Jan. 16, 2018 )


CLON CATGTTGGCTGCTGCCGAGGT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
CHRO chr01
EVAL 100.00
COOR W/16666-16686

HITS Os01g01040[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
TITL expressed protein (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150453); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150452); (PASA (rice_osa1r5_gm
LOCN 300-UTR3
COOR W/13401-13778,14185-14276,14360-15060,15303-15373,15770-15859,15944-16123,16333-16395



hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |