RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01190 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL hydrolase, acting on ester bonds, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06766 (update, updateIDs: 13, (gene: 12001.t00019, model: 12001.m06766)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06766.) ;
COOR C/86627-88270

HITS CI226305 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR C/86455-87008
HITS CI109139 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR C/86466-87015
NOTE CI139169 CI275865 CI402724 CI140875 CI048647 
HITS CI349700 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR C/86560-87017
NOTE CI198824 
HITS CI135778 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR C/86565-87264
NOTE CI099257 CI367268 CI048745 CI139827 
HITS J033023E01 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.77
LOCN Exon
COOR C/86565-88267
HITS BT065638 [GenBank] 
TYPE Maize cDNA
EVAL e-150
LOCN Exon
COOR W/86649-86693,86779-86822,86932-86974,87109-87169,87502-87634,87701-87744,87895-88016
NOTE ZM_BFb0379F21
HITS BT068962 [GenBank] 
TYPE Maize cDNA
EVAL e-149
LOCN Exon
COOR W/86649-86693,86779-86819,86931-86965,86959-86995,87109-87169,87206-87226,87502-87634,87737-87754,87895-88023
NOTE ZM_BFb0054J17
HITS BT069343 [GenBank] 
TYPE Maize cDNA
EVAL e-149
LOCN Exon
COOR W/86649-86693,86779-86819,86931-86965,86959-86995,87109-87169,87206-87226,87502-87634,87737-87754,87895-88023
NOTE ZM_BFc0140M06
HITS At3g48610 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-158
LOCN Exon
COOR W/86649-86691,86776-86818,86922-86988,86980-87048,87120-87236,87182-87243,87496-87626,87531-87559,87865-87976,87964-87984,88023-88063,88150-88192
HITS Os-33296-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 100.00
LOCN Exon
COOR C/86650-86709
HITS Os-33296-1-S1_x_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 100.00
LOCN Exon
COOR C/86653-87155
HITS BT083833 [GenBank] 
TYPE Maize cDNA
EVAL 0.0
LOCN Exon
COOR W/86667-86706,86776-86812,86808-86828,86935-86981,86950-86984,87103-87162,87137-87147,87164-87228,87200-87222,87266-87297,87490-87618,87555-87616,87686-87704,87865-87968,87912-87938,87991-88017,88029-88054,88150-88190
NOTE ZM_BFb0044G16
HITS GSNU_Ds264 [Seq] [About GSNU Ds] [iSect Primer] [Request/Order] 
TYPE GSNU Ds
EVAL 0.0
LOCN Exon
COOR C/86676-87090
HITS RdSpm4586_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-50
LOCN Exon
COOR W/86702-86810
HITS RdSpm1050A_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-37
LOCN Exon
COOR W/86731-86809
HITS RdSpm1050B_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-37
LOCN Exon
COOR W/86731-86809
HITS RdSpm1053B_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-37
LOCN Exon
COOR W/86731-86809
HITS RdSpm1054_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-37
LOCN Exon
COOR W/86731-86809
HITS RdSpm1068B_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-37
LOCN Exon
COOR W/86731-86809
HITS RdSpm1055_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-36
LOCN Exon
COOR W/86733-86809
HITS RdSpm1061_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD dSpm
EVAL 2e-34
LOCN Exon
COOR W/86736-86809
HITS At1g07230 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-139
LOCN Exon
COOR W/86776-86821,86931-86994,87105-87223,87502-87634,87597-87668,87865-87983,87979-88001,88060-88070,88144-88165
HITS At2g26870 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-134
LOCN Exon
COOR W/86776-86817,86970-87140,86980-87001,87502-87692,87591-87664,87832-87932,87964-87981,88150-88175
HITS RGT6237B_5.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] 
TYPE UCD Ac/Ds
EVAL 6e-07
LOCN Exon
COOR W/86778-86809
HITS BT055488 [GenBank] 
TYPE Maize cDNA
EVAL e-149
LOCN Exon
COOR W/86779-86819,86932-86974,87109-87169,87502-87634,87895-88016
NOTE ZM_BFb0379K05
HITS At3g03520 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-121
LOCN Exon
COOR W/86893-86930,86925-86940,86962-86987,87105-87223,87122-87138,87502-87634,87597-87668,87811-87904,87964-87981,88144-88167
HITS At3g03530 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-111
LOCN Exon
COOR W/86899-86925,86937-86947,86968-86978,87015-87046,87029-87043,87105-87176,87137-87168,87502-87634,87588-87667,87868-87980,88183-88219
HITS At3g03540 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-118
LOCN Exon
COOR W/86899-86925,86968-86978,86988-87001,87123-87235,87137-87150,87502-87629,87588-87667,87874-87995,88072-88125,88089-88102,88180-88215
HITS GATCCCGCCGCCATCTTCCT [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/86911-86930 NOTE 0 0 0 0 0 54 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCCGCCGCCATCTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/86914-86930 NOTE 0 0 0 0 0 44 1 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCACGGCGACACCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/87137-87153 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 20 0 0 0 HITS CI606041 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/87841-88267 HITS CI572408 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/87881-88323 NOTE CI657292 CI304282 CI304240 HITS SHIP_ZS3572 [Seq] [About SHIP] [Vector] [SHIP Details] [Order] TYPE SHIP T-DNA EVAL 2e-28 LOCN 300-UTR5 COOR W/88311-88379

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |