RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01170 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL expressed protein (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06764.) ;
COOR W/82181-82402,82539-82632,82737-82888,83014-83101,83201-84483,85093-85200,85302-85385

HITS AY020251 [GenBank] 
TYPE Rice Markers
EVAL 1e-49
LOCN Exon
COOR W/82053-82152,82178-82276
HITS J033131A17 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.83
LOCN Exon
COOR W/82139-82402,82539-82632,82737-82888,83014-83101,83201-84483,85093-85200,85302-85646
HITS CI621668 [GenBank] 
TYPE Rice EST ctgs
EVAL e-120
LOCN Exon
COOR W/82178-82404,82541-82630,82736-82809
HITS Os-32622-2-S1_x_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 100.00
LOCN Exon
COOR W/82331-82402,82539-82632,82737-82888,83014-83099
HITS At3g23740 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 4e-22
LOCN Exon
COOR W/82548-82574,84265-84333,84470-84533
HITS CU325154 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] 
TYPE Genoplante T-DNA
EVAL 0.0
LOCN Exon
COOR W/84030-84675
HITS Os-32622-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 100.00
LOCN Exon
COOR W/84340-84483,85093-85200,85302-85605
HITS CR287701 [GenBank] 
TYPE Rice EST ctgs
EVAL e-143
LOCN Exon
COOR C/84347-84484,85097-85200,85302-85567
HITS PFG_1B-22222.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] 
TYPE PFG T-DNA
EVAL e-112
LOCN Intron
COOR C/84989-85222,84989-85222
NOTE C10652  2717  Manan  T-DNA Right Border
HITS CI388348 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/85093-85200,85302-85647
NOTE CI388445 
HITS GATCTATCCAGCTTACCTGG [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/85409-85428 NOTE 0 0 0 0 0 137 0 0 7 0 0 11 0 0 0 0 0 0 HITS GATCTATCCAGCTTACC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/85409-85425 NOTE 0 0 0 0 0 93 0 0 5 0 0 7 0 0 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |