RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01160 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL chaperone protein dnaJ 20, chloroplast precursor, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06763 (update, updateIDs: 123112, (gene: 12001.t00016, model: 12001.m06763)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06763.) ;
COOR W/79309-79734,80520-80666

HITS RMD_04Z11JL41 [Seq] [About RMD] [Trait] [iSect Primer] [Request] 
TYPE RMD T-DNA
EVAL e-149
LOCN 300-UTR5
COOR C/78924-79199
HITS AU172532 [GenBank] 
TYPE Rice EST ctgs
EVAL 2e-83
LOCN Exon
COOR W/79230-79304,79387-79602
NOTE AU163586 CI742931 
HITS CATGGCTCTTCTCTTCTCTCT [About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
EVAL 100.00
LOCN Exon
COOR C/79291-79311
HITS At4g13830 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 3e-27
LOCN Exon
COOR W/79447-79524,80526-80568
HITS BT017906 [GenBank] 
TYPE Maize cDNA
EVAL 4e-11
LOCN Exon
COOR W/79468-79680
NOTE BT017906
HITS DQ244199 [GenBank] 
TYPE Maize cDNA
EVAL 4e-08
LOCN Exon
COOR W/79468-79569,79600-79671
NOTE DQ244199
HITS GATCCCGAGTAGGTCGTACA [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/79472-79491 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 HITS DQ245808 [GenBank] TYPE Maize cDNA EVAL 3e-10 LOCN Exon COOR W/79474-79560,79570-79671 NOTE DQ245808 HITS GATCCCGAGTAGGTCGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/79475-79491 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 HITS CI002217 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/80518-81051 HITS CI016518 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/80567-81080 HITS CATGACGAAGGATTCAGAGGA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR W/80588-80608 HITS CI149195 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/80605-81104 NOTE AU172533 CI525185 HITS Os-5648-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 99.74 LOCN Exon COOR W/80641-81029 HITS GATCGTAATGCTTCCAAAGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/80671-80690 NOTE 0 0 21 0 0 3 0 0 0 0 0 0 0 0 0 29 0 48 HITS GATCGTAATGCTTCCAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/80671-80687 NOTE 0 0 27 0 0 2 0 0 0 0 0 0 0 0 0 37 0 41

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |