RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01150 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL nucleic acid binding protein, putative, expressed (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00015 = 12001.m150455); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00015 = 12001.m100000); PASA (rice_osa1r5_gma
COOR W/69705-70737,71270-71783,72421-73810

HITS CI623793 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/69577-69967
HITS CI652112 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/69587-69984
HITS CI606793 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/69601-70043
NOTE CI579735 CI602946 CI746911 CI621304 CI751045 
HITS J013123J12 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.98
LOCN Exon
COOR W/69618-70737,71270-71783,72421-74006,74126-74130,74135-75151
HITS J033128C08 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.95
LOCN Exon
COOR W/69625-70737,71270-71783,72421-74012,74015-74501
HITS CI614318 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/69654-70085
HITS GATCGACGGGGCTAGGGTTT [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR5 COOR C/69672-69691 NOTE 0 0 0 0 0 0 0 0 0 20 0 0 0 0 0 0 0 0 HITS GATCGACGGGGCTAGGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR5 COOR C/69675-69691 NOTE 0 0 0 0 0 0 0 0 0 34 0 0 0 0 0 0 0 0 HITS BT053830 [GenBank] TYPE Maize cDNA EVAL e-173 LOCN Exon COOR W/69701-69720,69756-69774,70023-70136,70157-70184,70220-70274,70290-70300,70301-70320,70312-70363,70373-70406,70464-70508,70524-70546,70547-70596,70597-70656,70657-70672,70703-70724,71272-71361,71515-71527,71537-71570,71562-71616,71617-71628,71697-71728,71729-71740,72426-72546,72781-72806,72804-72908,72893-72965,72914-72948,73026-73096,73153-73233,73889-73910,73953-73975,74122-74153 NOTE ZM_BFb0214H18 HITS PFG_1B-21139.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 1e-61 LOCN Exon COOR W/69717-70070 NOTE C10261 2717 Dongjin T-DNA Left Border HITS CI564232 [GenBank] TYPE Rice EST ctgs EVAL 6e-63 LOCN Exon COOR W/69782-69884,69934-70209 HITS At3g23900 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 2e-77 LOCN Exon COOR W/70014-70127,70261-70290,70326-70392,70436-70454,70528-70586,71302-71373,71516-71588,71601-71647,72417-72470,72768-72787 HITS SHIP_ZSA126 [Seq] [About SHIP] [Vector] [SHIP Details] [Order] TYPE SHIP T-DNA EVAL 1e-16 LOCN Exon COOR C/71403-71455 HITS SHIP_ZSX0227.B [Seq] [About SHIP] [Vector] [SHIP Details] [Order] TYPE SHIP T-DNA EVAL 1e-16 LOCN Exon COOR C/71403-71455 HITS BT016224 [GenBank] TYPE Maize cDNA EVAL 2e-66 LOCN Exon COOR W/72426-72860,72893-73099,73739-73807,73885-74014,74025-74147 NOTE BT016224 HITS CI624135 [GenBank] TYPE Rice EST ctgs EVAL e-110 LOCN Exon COOR W/72744-72950,72957-73144 NOTE CV723843 HITS J033147H07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.83 LOCN Exon COOR W/72744-74501 HITS GTTCAGAGCGAGGACTC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Exon COOR W/73514-73530 NOTE 0 13 0 0 0 0 HITS GATCAGGGTATCCAGGAAGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/73628-73647 NOTE 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 HITS GATCAGGGTATCCAGGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/73628-73644 NOTE 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 HITS CI275866 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/73709-74358 NOTE CI759642 CI342501 CI155788 CI368168 HITS GATCAGTGGATGCAGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN 300-UTR3 COOR W/73876-73892 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 HITS CI338411 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR3 COOR W/73901-74372 NOTE CI533460 HITS CI372700 [GenBank] TYPE Rice EST ctgs EVAL e-161 LOCN 300-UTR3 COOR W/73905-74005,74127-74419 NOTE D15940 HITS Os-15960-1-S1_a_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 96.46 LOCN 300-UTR3 COOR W/73905-74494 HITS CI273032 [GenBank] TYPE Rice EST ctgs EVAL e-138 LOCN 300-UTR3 COOR W/73915-74006,74128-74208,74673-74782,74913-74991,76263-76512 NOTE CI393025 CI531142 CI324908 CI381648 BI800850 CI542733 CI387665 CI331104 CI425821 CI428844 CI424780 HITS CATGGAGAACTTGAGTGCTGA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/73957-73977

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |