RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01130 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL snurportin-1, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06760 (update, updateIDs: 123108, (gene: 12001.t00013, model: 12001.m06760)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06760.) ;
COOR C/60472-60585,60679-60822,61141-61233,61467-61581,61704-61954,62050-62233,62430-62464

HITS CK040746 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/60121-60474
HITS CI393880 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR C/60150-60585,60679-60730
NOTE BM421556 
HITS J043016L21 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 100.00
LOCN Exon
COOR C/60152-60585,60679-60822,61141-61233,61467-61581,61704-61954,62050-62233,62430-63104
HITS GATCCGAACAATATTCTACC [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/60181-60200 NOTE 0 0 238 0 0 7 0 0 0 0 0 0 0 62 0 31 0 0 HITS GATCCGAACAATATTCT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/60181-60197 NOTE 0 0 191 0 0 6 0 0 0 0 0 0 0 68 0 26 0 0 HITS CI343954 [GenBank] TYPE Rice EST ctgs EVAL e-143 LOCN Exon COOR C/60228-60585,60682-60824 NOTE CI016681 HITS CATGATAGTATTAGCTTGATT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/60285-60305 HITS CATGCTCCCATTCCATCCAAA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/60302-60322 HITS GATCAGACAAGGAGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR C/60428-60444 NOTE 2 0 0 0 0 0 29 0 0 0 0 0 0 0 0 0 0 0 HITS Os-45872-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR C/60515-60585,60679-60822,61141-61233,61467-61488 HITS GATCTCGTTGCCTCGATTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/60521-60540 NOTE 0 0 0 0 0 0 13 0 0 0 0 0 0 0 0 0 0 0 HITS GATCTCGTTGCCTCGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/60524-60540 NOTE 0 0 0 0 0 0 12 0 0 0 0 0 0 0 0 0 0 0 HITS At4g24880 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL e-113 LOCN Exon COOR W/60594-60631,60699-60724,60825-60874,61178-61196,61459-61501,61583-61622,61790-61845,61984-62077,62002-62031,62114-62151,62232-62274,62530-62570,62630-62670,62752-62793 HITS PFG_4A-00511.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR C/61142-61527 NOTE A40432 2715 Dongjin T-DNA Right Border HITS PFG_4A-00506.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR C/61154-61781 NOTE A40425 2715 Dongjin T-DNA Right Border HITS GATCCTCCAGTTGTCTTTGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/61169-61188 NOTE 0 0 0 0 0 0 0 0 0 107 0 0 0 0 13 0 0 0 HITS GATCCTCCAGTTGTCTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/61172-61188 NOTE 0 0 0 0 0 0 0 0 0 81 0 0 0 0 9 0 0 0 HITS GATCCAGCACAATCTGATTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/61221-61240 NOTE 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCAGCACAATCTGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/61221-61237 NOTE 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 HITS SAC3C07 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] TYPE Genoplante T-DNA EVAL e-156 LOCN Intron COOR C/61376-61670 HITS CATGCTGCTCACTTGGGACTT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR W/61466-61486 HITS CI124867 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/61618-62341 HITS Os-13225-1-S2_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 99.81 LOCN Exon COOR W/61740-62280 HITS BT086877 [GenBank] TYPE Maize cDNA EVAL 6e-57 LOCN Exon COOR C/61765-61812,61787-61799,61921-61973,61928-61942,62023-62045,62172-62232,62389-62408,62488-62527 NOTE ZM_BFb0014A14 HITS PFG_4A-00506.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 1e-74 LOCN Exon COOR W/61811-61960 NOTE A40424 2715 Dongjin T-DNA Left Border HITS BT086858 [GenBank] TYPE Maize cDNA EVAL 2e-39 LOCN Exon COOR C/62036-62085,62042-62063,62176-62232,62379-62403,62488-62527 NOTE ZM_BFa0079A09 HITS GATCCTTTGTTGAAACTTGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR W/62262-62281 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 22 0 0 0 0 HITS GATCCTTTGTTGAAACT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Intron COOR W/62262-62278 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |