RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01120 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL E-1 enzyme, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m97447 (update, updateIDs: 9, (gene: 12001.t00012, model: 12001.m97447)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06759 (updat
COOR W/58906-59097,59187-59707,59798-59916,60050-60147

HITS CI685077 [GenBank] 
TYPE Rice EST ctgs
EVAL e-133
LOCN Exon
COOR W/58857-59097,59187-59305
NOTE CI688016 CI768080 
HITS CI580132 [GenBank] 
TYPE Rice EST ctgs
EVAL e-128
LOCN Exon
COOR W/58862-59097,59187-59379
HITS J013127C12 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.83
LOCN Exon
COOR W/58862-59097,59187-59707,59798-59916,60050-60378
HITS CI566607 [GenBank] 
TYPE Rice EST ctgs
EVAL e-139
LOCN Exon
COOR W/58872-59097,59187-59446
NOTE CI574261 CI598620 CI288359 CI680753 CI290288 
HITS 006-303-C10 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 100.00
LOCN Exon
COOR W/58872-59097,59187-59707,59798-59916,60050-60319
HITS 001-038-F07 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 100.00
LOCN Exon
COOR W/58876-59097,59187-59707,59798-59916,60050-60314
HITS 006-310-A09 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 100.00
LOCN Exon
COOR W/58876-59097,59187-59707,59798-59916,60050-60314
HITS 001-133-E05 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.84
LOCN Exon
COOR W/58914-59097,59187-59707,59798-59916,60050-61981,61983-62339
HITS CF325202 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/58931-59097,59187-59579
NOTE CF325436 
HITS BT036753 [GenBank] 
TYPE Maize cDNA
EVAL 3e-72
LOCN Exon
COOR W/59184-59225,59252-59274,59301-59320,59318-59349,59424-59479,59591-59615,59610-59654,59731-59792,59796-59836,59924-59954,60037-60056,60098-60116
NOTE ZM_BFb0137I23
HITS BT016682 [GenBank] 
TYPE Maize cDNA
EVAL 7e-54
LOCN Exon
COOR W/59193-59651,59658-59708,59802-59918,60046-60138
NOTE BT016682
HITS BT040073 [GenBank] 
TYPE Maize cDNA
EVAL 4e-66
LOCN Exon
COOR W/59193-59231,59252-59272,59301-59320,59318-59346,59424-59456,59519-59536,59592-59611,59658-59674,59785-59801,59802-59840,59924-59954,60037-60056,60098-60116
NOTE ZM_BFc0063H19
HITS BT042841 [GenBank] 
TYPE Maize cDNA
EVAL 6e-49
LOCN Exon
COOR W/59193-59231,59275-59302,59307-59343,59379-59449,59592-59611,59802-59840,60046-60076,60140-60171
NOTE ZM_BFc0049L22
HITS At5g53850 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 2e-34
LOCN Exon
COOR W/59193-59231,59272-59297,59310-59343,59385-59453,59521-59566
HITS CI670369 [GenBank] 
TYPE Rice EST ctgs
EVAL e-131
LOCN Exon
COOR W/59472-59708,59799-59917,60051-60126
HITS Os-13225-1-S1_a_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 100.00
LOCN Exon
COOR W/59581-59707,59798-59916,60050-60146
HITS GATCGCCGTGTGCAGCGGTG [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/59648-59667 NOTE 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 0 0 0 HITS GATCGCCGTGTGCAGCG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/59651-59667 NOTE 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 HITS GATCCTCTTCTTGACAGACG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/59864-59883 NOTE 0 0 0 0 0 0 0 0 0 2 0 0 0 8 0 6 0 0 HITS GATCCTCTTCTTGACAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/59864-59880 NOTE 0 0 0 0 0 0 0 0 0 2 0 0 0 6 0 9 0 0 HITS PFG_3A-17553.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/60000-60655 NOTE A33034 2715 Dongjin T-DNA Right Border HITS PFG_2D-40602.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/60001-60573 NOTE D08784 2772 Dongjin T-DNA Right Border HITS PFG_2D-40602.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 1e-58 LOCN Intron COOR W/60001-60115 NOTE D08784 2772 Dongjin T-DNA Right Border HITS BI812815 [GenBank] TYPE Rice EST ctgs EVAL e-165 LOCN Exon COOR W/60046-60384 NOTE BM038512 BM419748 CI005250 CI009527 CI011845 CI013900 CI020164 CI097839 CI167436 CI210389 CI324785 CI331516 CI331807 CI357544 CI425396 CI459042 CI467083 CI551725 CI423020 HITS BT016682 [GenBank] TYPE Maize cDNA EVAL 1e-07 LOCN Exon COOR W/60046-60138 NOTE BT016682 HITS CK040746 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/60121-60474 HITS CI393880 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR3 COOR C/60150-60585,60679-60730 NOTE BM421556 HITS J043016L21 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 100.00 LOCN 300-UTR3 COOR C/60152-60585,60679-60822,61141-61233,61467-61581,61704-61954,62050-62233,62430-63104 HITS GATCCGAACAATATTCTACC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/60181-60200 NOTE 0 0 238 0 0 7 0 0 0 0 0 0 0 62 0 31 0 0 HITS GATCCGAACAATATTCT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/60181-60197 NOTE 0 0 191 0 0 6 0 0 0 0 0 0 0 68 0 26 0 0 HITS CI343954 [GenBank] TYPE Rice EST ctgs EVAL e-143 LOCN 300-UTR3 COOR C/60228-60585,60682-60824 NOTE CI016681 HITS CATGATAGTATTAGCTTGATT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/60285-60305 HITS CATGCTCCCATTCCATCCAAA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/60302-60322 HITS GATCAGACAAGGAGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR C/60428-60444 NOTE 2 0 0 0 0 0 29 0 0 0 0 0 0 0 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |