RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01110 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL conserved hypothetical protein
COOR W/52716-52720,53886-54774

HITS AGAATTATCCGATCCGA [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN 300-UTR5 COOR W/52537-52553 NOTE 0 0 0 1 0 0 HITS TTAAGATTCTGAGAAGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/52834-52850 NOTE 0 0 0 0 5 0 HITS TTTTCTGGACTCTATAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/52919-52935 NOTE 0 4 0 0 0 0 HITS GCTTTTGGTCCAGATTC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/52949-52965 NOTE 0 0 0 0 0 5 HITS AAAGCTGGATTGTTTAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/52961-52977 NOTE 2 0 0 0 0 0 HITS CACAAGGTTTCACATAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53481-53497 NOTE 0 1 0 0 0 0 HITS GATCGTGGACCTATGTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN Intron COOR C/53491-53507 NOTE 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 HITS AGATCGTGGACCTATGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/53492-53508 NOTE 0 2 0 0 0 0 HITS GAACGCTTTGCAAGATC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/53504-53520 NOTE 0 9 0 0 0 4 HITS AAAGCGTTCATCAAGGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53512-53528 NOTE 0 0 0 1 0 0 HITS CTGGTCCAAAGCGTCGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53555-53571 NOTE 0 0 2 0 0 0 HITS TGGTCCAAAGCGTCGTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53556-53572 NOTE 0 2 0 0 0 0 HITS TCCAAAGCGTCGTTTGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53559-53575 NOTE 0 0 2 0 0 0 HITS CCAAAGCGTCGTTTGAC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53560-53576 NOTE 0 0 3 6 0 0 HITS GTCGTTTGACCGTGGTC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/53567-53583 NOTE 0 0 1 0 0 0 HITS ATATCATCGTCTACGTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/53601-53617 NOTE 0 0 0 0 0 4 HITS GATCCCGGCGACTCTGTTCG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 2 LOCN Intron COOR W/53664-53683 NOTE 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 HITS GATCCCGGCGACTCTGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN Intron COOR W/53664-53680 NOTE 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 HITS PFG_2C-60242.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 9e-54 LOCN Exon COOR W/53959-54099 NOTE C15056 2717 Dongjin T-DNA Right Border HITS PFG_2C-60242.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 4e-99 LOCN Exon COOR W/54151-54430 NOTE C15056 2717 Dongjin T-DNA Right Border HITS OsAffx-30714-2-S1_s_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/54185-54683 HITS PFG_2C-60242.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-102 LOCN Exon COOR C/54224-54430 NOTE C15057 2717 Dongjin T-DNA Left Border HITS TCTTCCTCGACGACGGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Exon COOR W/54724-54740 NOTE 0 0 5 0 0 0 HITS CGCCGTCGTCGAGGAAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Exon COOR C/54725-54741 NOTE 0 0 3 0 0 0 HITS GGATTTAGATGAAACAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN 300-UTR3 COOR W/54907-54923 NOTE 0 0 0 0 2 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |