RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01070 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL expressed protein (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00007 = 12001.m42818); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06754.) ;
COOR W/26742-26778,26948-27030,27537-27608,27687-27765,28060-28127,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-30926

HITS PFG_3A-09614.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] 
TYPE PFG T-DNA
EVAL 0.0
LOCN 300-UTR5
COOR W/26601-27242
NOTE A21386  2715  Dongjin  T-DNA Right Border
HITS CI618591 [GenBank] 
TYPE Rice EST ctgs
EVAL 3e-76
LOCN Exon
COOR W/26620-26776,26946-27035,27542-27611,27690-27767,28061-28118
HITS J033111I18 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.80
LOCN Exon
COOR W/26620-26778,26948-27030,27537-27608,27687-27765,28060-28127,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-31255
HITS CF280733 [GenBank] 
TYPE Rice EST ctgs
EVAL 4e-64
LOCN Exon
COOR W/26655-26779,26949-27035,27542-27606,27685-27766,28061-28134,28307-28410
NOTE CI763167 CI618779 
HITS Os-46612-1-S1_x_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] 
TYPE Affy GeneChip
EVAL 84.83
LOCN Exon
COOR W/26746-26778,28060-28127,28307-28408,29344-29388,30076-30132,30202-30273,30345-30420
HITS ACACTATCGATGAATGG [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27204-27220 NOTE 0 2 0 0 0 0 HITS CACTTGTGATATGACGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27224-27240 NOTE 44 0 0 0 0 0 HITS TTGTTTCATCTAGTATG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27246-27262 NOTE 0 0 0 0 28 39 HITS TGTTTCATCTAGTATGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27247-27263 NOTE 0 0 0 0 0 1 HITS ATGGCTGGTAATAGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27292-27308 NOTE 0 0 0 0 0 24 HITS CTGTTTCACCTAGGACG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/27319-27335 NOTE 0 40 0 1 0 0 HITS ATTCACCCGCGAGATGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/27341-27357 NOTE 0 3 0 0 1 0 HITS ATCTCGCGGGTGAATCT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27343-27359 NOTE 1 0 0 0 0 0 HITS AGTGCCAAGTGTCAAAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27413-27429 NOTE 0 0 0 0 0 2 HITS TGTGGTTTTCTGCAACT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27434-27450 NOTE 1 0 0 0 0 0 HITS GTGGTTTTCTGCAACTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27435-27451 NOTE 0 7 0 0 0 2 HITS CB651349 [GenBank] TYPE Rice EST ctgs EVAL e-145 LOCN Exon COOR W/27506-27766,28061-28133,28307-28409,29180-29271,29347-29419,29515-29546,29630-29816 HITS BT060997 [GenBank] TYPE Maize cDNA EVAL 1e-47 LOCN Exon COOR W/27558-27577,27687-27713,27766-27792,28304-28340,29182-29211,29305-29326,29344-29368,29630-29658,29710-29737,30342-30367,30777-30807,30856-30882 NOTE ZM_BFb0083J10 HITS BT066602 [GenBank] TYPE Maize cDNA EVAL 1e-47 LOCN Exon COOR W/27558-27577,27687-27713,27766-27792,28304-28340,29182-29211,29305-29326,29344-29368,29630-29658,29710-29737,30342-30367,30777-30807,30856-30882 NOTE ZM_BFb0038D23 HITS GTTTTCACAGGTTTTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/28676-28692 NOTE 0 0 0 0 0 1 HITS PFG_1C-03852.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/28899-29436 NOTE B03027 2707 Hwayoung T-DNA Right Border HITS CB651350 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/30001-30133,30203-30271,30343-30418,30776-31141,31151-31191 NOTE CD670876 D16001 CR290596 CF280734 HITS GATCACCTGTAACAGAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/30248-30264 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 HITS RMD_03Z11CT33-3 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/30542-31106 HITS PFG_3A-05546.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/30599-31166 NOTE A15657 2715 Dongjin T-DNA Left Border HITS Os-26562-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 92.34 LOCN Exon COOR W/30778-31272 HITS CI384376 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/30802-31141,31151-31255 HITS GATCCCAGGAGCTATCAAAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/30811-30830 NOTE 0 0 23 0 3 25 47 39 0 0 0 54 19 57 1 19 0 7 HITS GATCCCAGGAGCTATCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/30811-30827 NOTE 0 0 18 0 2 19 40 32 0 0 0 39 13 48 1 16 0 6 HITS CI329155 [GenBank] TYPE Rice EST ctgs EVAL e-176 LOCN Exon COOR W/30829-31141,31151-31273 NOTE CI546444 HITS ND2053_0_702_1A [Seq] [GenBank] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL e-162 LOCN Exon COOR W/30852-31141,31151-31401 HITS PFG_2C-30136.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/30890-31521 NOTE C13113 2717 Dongjin T-DNA Right Border HITS CATGGCATCACTTTCACCTAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/31031-31051 HITS BM038316 [GenBank] TYPE Rice EST ctgs EVAL 9e-66 LOCN 300-UTR3 COOR W/31094-31141,31151-31296 CODE Os01g01070 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL expressed protein (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00007 = 12001.m42818); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06754.) ; COOR W/26742-26778,26948-27030,27537-27608,27687-27765,28060-28133,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-30926 HITS PFG_3A-09614.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/26601-27242 NOTE A21386 2715 Dongjin T-DNA Right Border HITS CI618591 [GenBank] TYPE Rice EST ctgs EVAL 3e-76 LOCN Exon COOR W/26620-26776,26946-27035,27542-27611,27690-27767,28061-28118 HITS J033111I18 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.80 LOCN Exon COOR W/26620-26778,26948-27030,27537-27608,27687-27765,28060-28127,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-31255 HITS CF280733 [GenBank] TYPE Rice EST ctgs EVAL 4e-64 LOCN Exon COOR W/26655-26779,26949-27035,27542-27606,27685-27766,28061-28134,28307-28410 NOTE CI763167 CI618779 HITS Os-46612-1-S1_x_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 84.83 LOCN Exon COOR W/26746-26778,28060-28127,28307-28408,29344-29388,30076-30132,30202-30273,30345-30420 HITS ACACTATCGATGAATGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27204-27220 NOTE 0 2 0 0 0 0 HITS CACTTGTGATATGACGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27224-27240 NOTE 44 0 0 0 0 0 HITS TTGTTTCATCTAGTATG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27246-27262 NOTE 0 0 0 0 28 39 HITS TGTTTCATCTAGTATGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27247-27263 NOTE 0 0 0 0 0 1 HITS ATGGCTGGTAATAGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27292-27308 NOTE 0 0 0 0 0 24 HITS CTGTTTCACCTAGGACG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/27319-27335 NOTE 0 40 0 1 0 0 HITS ATTCACCCGCGAGATGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/27341-27357 NOTE 0 3 0 0 1 0 HITS ATCTCGCGGGTGAATCT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27343-27359 NOTE 1 0 0 0 0 0 HITS AGTGCCAAGTGTCAAAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27413-27429 NOTE 0 0 0 0 0 2 HITS TGTGGTTTTCTGCAACT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27434-27450 NOTE 1 0 0 0 0 0 HITS GTGGTTTTCTGCAACTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/27435-27451 NOTE 0 7 0 0 0 2 HITS CB651349 [GenBank] TYPE Rice EST ctgs EVAL e-145 LOCN Exon COOR W/27506-27766,28061-28133,28307-28409,29180-29271,29347-29419,29515-29546,29630-29816 HITS BT060997 [GenBank] TYPE Maize cDNA EVAL 1e-47 LOCN Exon COOR W/27558-27577,27687-27713,27766-27792,28304-28340,29182-29211,29305-29326,29344-29368,29630-29658,29710-29737,30342-30367,30777-30807,30856-30882 NOTE ZM_BFb0083J10 HITS BT066602 [GenBank] TYPE Maize cDNA EVAL 1e-47 LOCN Exon COOR W/27558-27577,27687-27713,27766-27792,28304-28340,29182-29211,29305-29326,29344-29368,29630-29658,29710-29737,30342-30367,30777-30807,30856-30882 NOTE ZM_BFb0038D23 HITS GTTTTCACAGGTTTTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/28676-28692 NOTE 0 0 0 0 0 1 HITS PFG_1C-03852.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/28899-29436 NOTE B03027 2707 Hwayoung T-DNA Right Border HITS CB651350 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/30001-30133,30203-30271,30343-30418,30776-31141,31151-31191 NOTE CD670876 D16001 CR290596 CF280734 HITS GATCACCTGTAACAGAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/30248-30264 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 HITS RMD_03Z11CT33-3 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/30542-31106 HITS PFG_3A-05546.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/30599-31166 NOTE A15657 2715 Dongjin T-DNA Left Border HITS Os-26562-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 92.34 LOCN Exon COOR W/30778-31272 HITS CI384376 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/30802-31141,31151-31255 HITS GATCCCAGGAGCTATCAAAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/30811-30830 NOTE 0 0 23 0 3 25 47 39 0 0 0 54 19 57 1 19 0 7 HITS GATCCCAGGAGCTATCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/30811-30827 NOTE 0 0 18 0 2 19 40 32 0 0 0 39 13 48 1 16 0 6 HITS CI329155 [GenBank] TYPE Rice EST ctgs EVAL e-176 LOCN Exon COOR W/30829-31141,31151-31273 NOTE CI546444 HITS ND2053_0_702_1A [Seq] [GenBank] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL e-162 LOCN Exon COOR W/30852-31141,31151-31401 HITS PFG_2C-30136.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/30890-31521 NOTE C13113 2717 Dongjin T-DNA Right Border HITS CATGGCATCACTTTCACCTAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/31031-31051 HITS BM038316 [GenBank] TYPE Rice EST ctgs EVAL 9e-66 LOCN 300-UTR3 COOR W/31094-31141,31151-31296

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |