RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01060 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL 40S ribosomal protein S5, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06753 (update, updateIDs: 5, (gene: 12001.t00006, model: 12001.m06753)); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00006 = 120
COOR W/24023-24088,24172-24443,24892-25095,25167-25221

HITS CI028440 [GenBank] 
TYPE Rice EST ctgs
EVAL e-148
LOCN 300-UTR5
COOR W/23363-23491,23503-23773
NOTE CI295822 
HITS PFG_3A-15432.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] 
TYPE PFG T-DNA
EVAL 5e-83
LOCN 300-UTR5
COOR C/23509-23909
NOTE A30012  2715  Dongjin  T-DNA Left Border
HITS CATGACGATATGATCCTGTAA [About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
EVAL 100.00
LOCN 300-UTR5
COOR W/23758-23778
HITS CR286953 [GenBank] 
TYPE Rice EST ctgs
EVAL e-151
LOCN Exon
COOR W/23938-24090,24169-24443,24892-25070
HITS OSIGCRA118O11 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] 
TYPE RiCD FL-cDNA
EVAL 95.63
LOCN Exon
COOR W/23938-24094,24172-24507,24597-24733,24797-25095,25167-25403
NOTE CT833926
HITS BX928430 [GenBank] 
TYPE Rice EST ctgs
EVAL e-146
LOCN Exon
COOR W/23940-24091,24169-24443,24892-25084
NOTE CF292056 CF337896 CI297643 CI646273 CF318959 CF327258 CI590291 CI605618 CI620470 CI636457 CV729681 
HITS OSIGCEA042M23 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] 
TYPE RiCD FL-cDNA
EVAL 99.77
LOCN Exon
COOR W/23940-24094,24172-24443,24892-25095,25167-25404
NOTE CT833925
HITS CF279573 [GenBank] 
TYPE Rice EST ctgs
EVAL e-150
LOCN Exon
COOR W/23945-24091,24169-24443,24893-25095
NOTE CF295653 CF332680 CI290212 CI607213 CI612061 CI671634 CI673538 CI703912 CI705946 CI764689 CV730712 
HITS 006-206-E02 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 100.00
LOCN Exon
COOR W/23945-24094,24172-24443,24892-25095,25167-25404
HITS J033028P14 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 98.91
LOCN Exon
COOR W/23945-24094,24172-24443,24892-25095,25167-25446
HITS CF330188 [GenBank] 
TYPE Rice EST ctgs
EVAL e-151
LOCN Exon
COOR W/23950-24091,24169-24443,24892-25096
NOTE CA754537 CV729200 D24128 C27646 AU062902 D39026 
HITS BT016516 [GenBank] 
TYPE Maize cDNA
EVAL 4e-86
LOCN Exon
COOR W/23987-24097,24169-24463,24881-25098,25164-25242
NOTE BT016516
HITS DQ245062 [GenBank] 
TYPE Maize cDNA
EVAL 1e-82
LOCN Exon
COOR W/24026-24097,24172-24443,24881-25098,25164-25220
NOTE DQ245062
HITS DQ245684 [GenBank] 
TYPE Maize cDNA
EVAL 2e-84
LOCN Exon
COOR W/24026-24097,24172-24441,24881-25098,25165-25218
NOTE DQ245684
HITS At2g37270 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 5e-92
LOCN Exon
COOR W/24026-24049,24172-24261,24262-24288,24391-24432,24504-24533,24881-24951,25095-25177,25134-25162
HITS At3g11940 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 6e-91
LOCN Exon
COOR W/24026-24049,24172-24261,24262-24297,24504-24533,24534-24545,24881-24951,25029-25050,25068-25141,25142-25171
HITS BT016445 [GenBank] 
TYPE Maize cDNA
EVAL 6e-89
LOCN Exon
COOR W/24038-24097,24169-24452,24881-25098,25164-25269
NOTE BT016445
HITS BT016589 [GenBank] 
TYPE Maize cDNA
EVAL 1e-86
LOCN Exon
COOR W/24038-24097,24169-24452,24881-25098,25164-25269
NOTE BT016589
HITS DQ244210 [GenBank] 
TYPE Maize cDNA
EVAL 8e-86
LOCN Exon
COOR W/24047-24097,24169-24463,24881-25098,25164-25242
NOTE DQ244210
HITS BT034354 [GenBank] 
TYPE Maize cDNA
EVAL 1e-85
LOCN Exon
COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277
NOTE ZM_BFc0007E22
HITS BT035455 [GenBank] 
TYPE Maize cDNA
EVAL 6e-85
LOCN Exon
COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277
NOTE ZM_BFb0063N20
HITS BT035846 [GenBank] 
TYPE Maize cDNA
EVAL 2e-87
LOCN Exon
COOR W/24169-24261,24320-24339,24405-24451,24452-24555,24890-24957,24958-24990,25072-25092,25128-25163,25165-25198,25246-25276
NOTE ZM_BFb0085N02
HITS BT041165 [GenBank] 
TYPE Maize cDNA
EVAL 1e-85
LOCN Exon
COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277
NOTE ZM_BFc0183I17
HITS BT055266 [GenBank] 
TYPE Maize cDNA
EVAL 1e-85
LOCN Exon
COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277
NOTE ZM_BFc0070F15
HITS BT055326 [GenBank] 
TYPE Maize cDNA
EVAL 1e-87
LOCN Exon
COOR W/24169-24259,24396-24432,24504-24543,24881-24951,25072-25092,25128-25163,25165-25198,25246-25276
NOTE ZM_BFb0013P20
HITS BT055372 [GenBank] 
TYPE Maize cDNA
EVAL 1e-85
LOCN Exon
COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277
NOTE ZM_BFb0089C19
HITS AU085712 [GenBank] 
TYPE Rice EST ctgs
EVAL e-134
LOCN Exon
COOR W/24199-24444,24894-25091,25163-25404
NOTE CI168243 CI193750 BI806341 CI759745 CI763067 CI167557 
HITS 002-144-D09 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 3.30
LOCN Exon
COOR W/24261-24287
HITS PFG_3A-12361.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] 
TYPE PFG T-DNA
EVAL e-138
LOCN Exon
COOR C/24270-24685,24751-24947
NOTE A25365  2715  Dongjin  T-DNA Left Border
HITS 002-169-E07 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 2.85
LOCN Exon
COOR W/24313-24345
HITS GATCTTCTTGCCGTTGTTGC [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/24329-24348 NOTE 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCTTCTTGCCGTTGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/24332-24348 NOTE 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS CI177635 [GenBank] TYPE Rice EST ctgs EVAL e-132 LOCN Exon COOR W/24338-24439,24888-25091,25163-25406 NOTE CI151856 CI165004 CR286823 HITS CI242607 [GenBank] TYPE Rice EST ctgs EVAL e-139 LOCN Exon COOR W/24353-24439,24888-25091,25163-25417 NOTE AU164624 HITS CI212564 [GenBank] TYPE Rice EST ctgs EVAL e-150 LOCN Exon COOR W/24367-24439,24888-25091,25163-25432 NOTE CI033268 CI345504 CI163489 CI167777 CI202659 CF279574 BI804885 CI355025 CI011748 BX928457 AU184148 CF295652 CF307353 HITS GATCATCCACCTCCTCACCG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 2 LOCN Exon COOR W/24381-24400 NOTE 41 0 0 0 28 149 50 0 9 42 217 186 25 7 50 3 0 3 HITS GATCATCCACCTCCTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN Exon COOR W/24381-24397 NOTE 40 0 0 0 44 114 79 0 10 46 253 252 33 7 54 4 2 3 HITS Os-4725-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 99.49 LOCN Exon COOR W/24406-24443,24892-25097,25167-25317 HITS BT065473 [GenBank] TYPE Maize cDNA EVAL 5e-41 LOCN Exon COOR W/24443-24470,24893-24959,24960-24990,25072-25093,25128-25162,25165-25198,25246-25276 NOTE ZM_BFb0175P06 HITS CI052473 [GenBank] TYPE Rice EST ctgs EVAL e-163 LOCN Exon COOR W/24888-25091,25163-25453 NOTE CI375053 CI386643 CI368468 CF329740 CI449343 CI485732 CI239541 BI805248 CI406852 CI548152 CI518076 CF292057 CI419078 CF332679 CI561338 CI563092 BQ907836 CF330187 AU312065 HITS PFG_3A-12361.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/25084-25570 NOTE A25366 2715 Dongjin T-DNA Right Border HITS CATGCTCTAATTCTGATATGT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Intron COOR W/25141-25161 HITS GATCTGAGTTCTTTATG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/25407-25423 NOTE 0 0 0 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 CODE Os01g01060 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL 40S ribosomal protein S5, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06753 (update, updateIDs: 5, (gene: 12001.t00006, model: 12001.m06753)); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00006 = 120 COOR W/24023-24094,24172-24443,24892-25095,25167-25221 HITS CATGACGATATGATCCTGTAA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR5 COOR W/23758-23778 HITS CR286953 [GenBank] TYPE Rice EST ctgs EVAL e-151 LOCN Exon COOR W/23938-24090,24169-24443,24892-25070 HITS OSIGCRA118O11 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] TYPE RiCD FL-cDNA EVAL 95.63 LOCN Exon COOR W/23938-24094,24172-24507,24597-24733,24797-25095,25167-25403 NOTE CT833926 HITS BX928430 [GenBank] TYPE Rice EST ctgs EVAL e-146 LOCN Exon COOR W/23940-24091,24169-24443,24892-25084 NOTE CF292056 CF337896 CI297643 CI646273 CF318959 CF327258 CI590291 CI605618 CI620470 CI636457 CV729681 HITS OSIGCEA042M23 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] TYPE RiCD FL-cDNA EVAL 99.77 LOCN Exon COOR W/23940-24094,24172-24443,24892-25095,25167-25404 NOTE CT833925 HITS CF279573 [GenBank] TYPE Rice EST ctgs EVAL e-150 LOCN Exon COOR W/23945-24091,24169-24443,24893-25095 NOTE CF295653 CF332680 CI290212 CI607213 CI612061 CI671634 CI673538 CI703912 CI705946 CI764689 CV730712 HITS 006-206-E02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 100.00 LOCN Exon COOR W/23945-24094,24172-24443,24892-25095,25167-25404 HITS J033028P14 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 98.91 LOCN Exon COOR W/23945-24094,24172-24443,24892-25095,25167-25446 HITS CF330188 [GenBank] TYPE Rice EST ctgs EVAL e-151 LOCN Exon COOR W/23950-24091,24169-24443,24892-25096 NOTE CA754537 CV729200 D24128 C27646 AU062902 D39026 HITS BT016516 [GenBank] TYPE Maize cDNA EVAL 4e-86 LOCN Exon COOR W/23987-24097,24169-24463,24881-25098,25164-25242 NOTE BT016516 HITS DQ245062 [GenBank] TYPE Maize cDNA EVAL 1e-82 LOCN Exon COOR W/24026-24097,24172-24443,24881-25098,25164-25220 NOTE DQ245062 HITS DQ245684 [GenBank] TYPE Maize cDNA EVAL 2e-84 LOCN Exon COOR W/24026-24097,24172-24441,24881-25098,25165-25218 NOTE DQ245684 HITS At2g37270 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 5e-92 LOCN Exon COOR W/24026-24049,24172-24261,24262-24288,24391-24432,24504-24533,24881-24951,25095-25177,25134-25162 HITS At3g11940 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 6e-91 LOCN Exon COOR W/24026-24049,24172-24261,24262-24297,24504-24533,24534-24545,24881-24951,25029-25050,25068-25141,25142-25171 HITS BT016445 [GenBank] TYPE Maize cDNA EVAL 6e-89 LOCN Exon COOR W/24038-24097,24169-24452,24881-25098,25164-25269 NOTE BT016445 HITS BT016589 [GenBank] TYPE Maize cDNA EVAL 1e-86 LOCN Exon COOR W/24038-24097,24169-24452,24881-25098,25164-25269 NOTE BT016589 HITS DQ244210 [GenBank] TYPE Maize cDNA EVAL 8e-86 LOCN Exon COOR W/24047-24097,24169-24463,24881-25098,25164-25242 NOTE DQ244210 HITS BT034354 [GenBank] TYPE Maize cDNA EVAL 1e-85 LOCN Exon COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277 NOTE ZM_BFc0007E22 HITS BT035455 [GenBank] TYPE Maize cDNA EVAL 6e-85 LOCN Exon COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277 NOTE ZM_BFb0063N20 HITS BT035846 [GenBank] TYPE Maize cDNA EVAL 2e-87 LOCN Exon COOR W/24169-24261,24320-24339,24405-24451,24452-24555,24890-24957,24958-24990,25072-25092,25128-25163,25165-25198,25246-25276 NOTE ZM_BFb0085N02 HITS BT041165 [GenBank] TYPE Maize cDNA EVAL 1e-85 LOCN Exon COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277 NOTE ZM_BFc0183I17 HITS BT055266 [GenBank] TYPE Maize cDNA EVAL 1e-85 LOCN Exon COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277 NOTE ZM_BFc0070F15 HITS BT055326 [GenBank] TYPE Maize cDNA EVAL 1e-87 LOCN Exon COOR W/24169-24259,24396-24432,24504-24543,24881-24951,25072-25092,25128-25163,25165-25198,25246-25276 NOTE ZM_BFb0013P20 HITS BT055372 [GenBank] TYPE Maize cDNA EVAL 1e-85 LOCN Exon COOR W/24169-24259,24317-24365,24504-24543,24881-24951,25068-25093,25120-25166,25165-25190,25240-25265,25266-25277 NOTE ZM_BFb0089C19 HITS AU085712 [GenBank] TYPE Rice EST ctgs EVAL e-134 LOCN Exon COOR W/24199-24444,24894-25091,25163-25404 NOTE CI168243 CI193750 BI806341 CI759745 CI763067 CI167557 HITS 002-144-D09 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 3.30 LOCN Exon COOR W/24261-24287 HITS PFG_3A-12361.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-138 LOCN Exon COOR C/24270-24685,24751-24947 NOTE A25365 2715 Dongjin T-DNA Left Border HITS 002-169-E07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 2.85 LOCN Exon COOR W/24313-24345 HITS GATCTTCTTGCCGTTGTTGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/24329-24348 NOTE 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCTTCTTGCCGTTGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/24332-24348 NOTE 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS CI177635 [GenBank] TYPE Rice EST ctgs EVAL e-132 LOCN Exon COOR W/24338-24439,24888-25091,25163-25406 NOTE CI151856 CI165004 CR286823 HITS CI242607 [GenBank] TYPE Rice EST ctgs EVAL e-139 LOCN Exon COOR W/24353-24439,24888-25091,25163-25417 NOTE AU164624 HITS CI212564 [GenBank] TYPE Rice EST ctgs EVAL e-150 LOCN Exon COOR W/24367-24439,24888-25091,25163-25432 NOTE CI033268 CI345504 CI163489 CI167777 CI202659 CF279574 BI804885 CI355025 CI011748 BX928457 AU184148 CF295652 CF307353 HITS GATCATCCACCTCCTCACCG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 2 LOCN Exon COOR W/24381-24400 NOTE 41 0 0 0 28 149 50 0 9 42 217 186 25 7 50 3 0 3 HITS GATCATCCACCTCCTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN Exon COOR W/24381-24397 NOTE 40 0 0 0 44 114 79 0 10 46 253 252 33 7 54 4 2 3 HITS Os-4725-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 99.49 LOCN Exon COOR W/24406-24443,24892-25097,25167-25317 HITS BT065473 [GenBank] TYPE Maize cDNA EVAL 5e-41 LOCN Exon COOR W/24443-24470,24893-24959,24960-24990,25072-25093,25128-25162,25165-25198,25246-25276 NOTE ZM_BFb0175P06 HITS CI052473 [GenBank] TYPE Rice EST ctgs EVAL e-163 LOCN Exon COOR W/24888-25091,25163-25453 NOTE CI375053 CI386643 CI368468 CF329740 CI449343 CI485732 CI239541 BI805248 CI406852 CI548152 CI518076 CF292057 CI419078 CF332679 CI561338 CI563092 BQ907836 CF330187 AU312065 HITS PFG_3A-12361.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/25084-25570 NOTE A25366 2715 Dongjin T-DNA Right Border HITS CATGCTCTAATTCTGATATGT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Intron COOR W/25141-25161 HITS GATCTGAGTTCTTTATG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/25407-25423 NOTE 0 0 0 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |