RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01040 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL expressed protein (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150453); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150452); (PASA (rice_osa1r5_gm
COOR W/13401-13778,14185-14276,14360-15060,15303-15373,15770-15859,15944-16123,16333-16395

HITS CI625109 [GenBank] 
TYPE Rice EST ctgs
EVAL e-179
LOCN Exon
COOR W/13094-13420
HITS M0079093 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] 
TYPE TRIM T-DNA
EVAL 0.0
LOCN Exon
COOR C/13094-13568
HITS CI586150 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/13141-13548
NOTE CI678924 CI748591 
HITS CI618194 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/13164-13567
NOTE CI618195 CI735990 
HITS CI576685 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/13201-13625
NOTE CI749418 
HITS J013104J17 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.91
LOCN Exon
COOR W/13201-13778,14185-14276,14360-15060,15303-15373,15770-15859,15944-16123,16333-16431,16536-16946
HITS BT083687 [GenBank] 
TYPE Maize cDNA
EVAL 0.0
LOCN Exon
COOR W/13370-13410,13411-13443,13512-13600,14188-14217,14361-14507,14511-14548,14664-14698,14796-14883,14887-14944,15016-15059,15089-15104,15310-15330,15743-15787,15944-15996,16042-16076
NOTE ZM_BFb0028O13
HITS M0068252 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] 
TYPE TRIM T-DNA
EVAL 0.0
LOCN Exon
COOR W/13525-14047
HITS CI309554 [GenBank] 
TYPE Rice EST ctgs
EVAL e-126
LOCN Exon
COOR W/13551-13779,14186-14276,14360-14511
HITS At5g16520 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-105
LOCN Exon
COOR W/13563-13604,13687-13721,14185-14212,14264-14277,14361-14593,14626-14734,14857-14922,15050-15162
HITS GATCCAGGTGTTCCCATTGC [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/14517-14536 NOTE 0 0 0 0 14 0 0 0 0 0 5 0 0 0 0 0 0 0 HITS GATCCAGGTGTTCCCAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/14520-14536 NOTE 0 0 0 0 20 0 0 0 0 0 9 0 0 0 0 0 0 0 HITS CB651212 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/14605-15060,15303-15373,15770-15857,15942-16059 NOTE CB677886 HITS CATCCTTCCTCGACAGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/15620-15636 NOTE 1 0 0 0 0 0 HITS PFG_K-04717.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-125 LOCN Intron COOR C/15664-15893 NOTE E07780 2715 Kitaake T-DNA Left Border HITS PFG_K-04717.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-115 LOCN Intron COOR C/15665-15893 NOTE E07780 2715 Kitaake T-DNA Left Border HITS GATCCAAGTTGCTAGGGCCC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/15970-15989 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 HITS GATCCAAGTTGCTAGGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/15973-15989 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 HITS GATCCTTCCACAAGAAAAGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/16044-16063 NOTE 0 0 14 0 0 0 0 0 10 0 0 0 0 29 0 6 0 0 HITS GATCCTTCCACAAGAAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/16044-16060 NOTE 0 0 12 0 0 0 0 0 16 35 21 6 0 227 0 9 0 0 HITS CB651213 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/16088-16122,16332-16431,16533-17120 NOTE CB677887 CI339996 CI517741 CI146392 CI338892 CI327677 EE591151 CI383713 HITS CI269991 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR3 COOR W/16472-16518,16526-17122 NOTE CI245780 CI100284 CI221838 CI456981 CR290902 CI224064 CI069513 CI530965 CI392378 HITS Os-27571-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN 300-UTR3 COOR W/16538-16890 HITS CATGTTGGCTGCTGCCGAGGT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/16666-16686 HITS CI127649 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR3 COOR W/16695-17126 NOTE CI552801 CI519244 CI522613 CI531748 CODE Os01g01040 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL expressed protein (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150453); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150452); (PASA (rice_osa1r5_gm COOR W/13401-13778,14185-14276,14360-15074 HITS CI625109 [GenBank] TYPE Rice EST ctgs EVAL e-179 LOCN Exon COOR W/13094-13420 HITS M0079093 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Exon COOR C/13094-13568 HITS CI586150 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/13141-13548 NOTE CI678924 CI748591 HITS CI618194 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/13164-13567 NOTE CI618195 CI735990 HITS CI576685 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/13201-13625 NOTE CI749418 HITS J013104J17 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.91 LOCN Exon COOR W/13201-13778,14185-14276,14360-15060,15303-15373,15770-15859,15944-16123,16333-16431,16536-16946 HITS BT083687 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/13370-13410,13411-13443,13512-13600,14188-14217,14361-14507,14511-14548,14664-14698,14796-14883,14887-14944,15016-15059,15089-15104,15310-15330,15743-15787,15944-15996,16042-16076 NOTE ZM_BFb0028O13 HITS M0068252 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Exon COOR W/13525-14047 HITS CI309554 [GenBank] TYPE Rice EST ctgs EVAL e-126 LOCN Exon COOR W/13551-13779,14186-14276,14360-14511 HITS At5g16520 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL e-105 LOCN Exon COOR W/13563-13604,13687-13721,14185-14212,14264-14277,14361-14593,14626-14734,14857-14922,15050-15162 HITS GATCCAGGTGTTCCCATTGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/14517-14536 NOTE 0 0 0 0 14 0 0 0 0 0 5 0 0 0 0 0 0 0 HITS GATCCAGGTGTTCCCAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/14520-14536 NOTE 0 0 0 0 20 0 0 0 0 0 9 0 0 0 0 0 0 0 HITS CB651212 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/14605-15060,15303-15373,15770-15857,15942-16059 NOTE CB677886

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |