RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01030 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL monocopper oxidase precursor, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06750 (update, updateIDs: 2, (gene: 12001.t00003, model: 12001.m06750)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06750.) ; (PASA (r
COOR W/9576-10615,10708-11073,11161-11239,11771-11973,12068-12161

HITS CI584894 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/9450-9858
HITS CI740385 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/9515-9860
HITS CI608918 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/9523-10022
NOTE CA753498 
HITS J033040A20 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.95
LOCN Exon
COOR W/9523-10615,10708-11073,11161-11239,11771-11973,12068-12487
HITS BT086104 [GenBank] 
TYPE Maize cDNA
EVAL e-102
LOCN Exon
COOR C/9605-9720,9858-9923,9953-10066,10094-10134,10135-10167,10168-10245,10403-10439,10434-10479,10591-10605,10643-10682
NOTE ZM_BFc0116K18
HITS At4g12420 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL 0.0
LOCN Exon
COOR W/9609-9643,9816-9899,10025-10064,10068-10204,10460-10476,10477-10595,10682-10812,10875-10931,10972-11003,11162-11188,11765-11812,11868-11900,11904-11924,12014-12049
HITS GATCCCCCGCCCCCGCC [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/9644-9660 NOTE 37 0 0 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 HITS At5g48450 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 0.0 LOCN Exon COOR W/9651-9671,9723-9837,10075-10161,10221-10305,10306-10341,10452-10467,10465-10540,10546-10564,10682-10812,10813-10843,11073-11195,11814-11837,11856-11895,11976-12045 HITS At5g51480 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 0.0 LOCN Exon COOR W/9654-9673,9726-9839,10052-10064,10075-10188,10192-10208,10212-10300,10301-10313,10457-10488,10489-10581,10606-10619,10712-10789,10908-10948,10946-10987,10988-10998,11162-11188,11765-11818,11900-11924,11925-11979 HITS AB261606 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/9657-9713,9723-9764,9816-10067,10068-10613,10682-10939,10952-11074,11162-11242,11765-11974 NOTE AB261606 HITS BT024030 [GenBank] TYPE Maize cDNA EVAL e-172 LOCN Exon COOR W/9657-9713,9725-10226,10266-10478,10491-10613,10712-11074,11158-11242,11768-11974 NOTE BT024030 HITS BT033687 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/9657-9675,9816-9899,9956-9972,10068-10210,10337-10413,10477-10502,10491-10532,10682-10767,10848-10893,10952-10992,11162-11188,11765-11834,11868-11901 NOTE ZM_BFc0117J14 HITS BT064483 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/9657-9675,9816-9899,9956-9972,10068-10210,10337-10413,10477-10502,10491-10532,10682-10767,10848-10893,10952-10992,11162-11188,11765-11834,11868-11901 NOTE ZM_BFc0174C07 HITS BT067590 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/9657-9675,9816-9899,9956-9972,10068-10210,10337-10413,10477-10502,10491-10532,10682-10767,10848-10893,10952-10992,11162-11188,11765-11834,11868-11901 NOTE ZM_BFc0095G02 HITS At4g25240 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 0.0 LOCN Exon COOR W/9657-9675,9726-9839,9840-9868,10052-10064,10075-10188,10192-10208,10212-10300,10304-10348,10475-10488,10489-10581,10682-10812,10908-10977,10978-11001,11083-11146,11765-11818,11871-11904,11908-11924 HITS BT067297 [GenBank] TYPE Maize cDNA EVAL 0.0 LOCN Exon COOR W/9726-9839,10068-10207,10435-10496,10491-10532,10578-10593,10682-10812,10991-11010,11162-11188,11768-11836,11973-12040 NOTE ZM_BFb0383G06 HITS BT087742 [GenBank] TYPE Maize cDNA EVAL e-104 LOCN Exon COOR W/9726-9827,9828-9867,9954-9975,9976-10054,10055-10066,10405-10416,10911-10957,10949-10969,11787-11811 NOTE ZM_BFb0181D04 HITS BT064280 [GenBank] TYPE Maize cDNA EVAL e-161 LOCN Exon COOR W/9873-9937,9987-10025,10068-10204,10308-10333,10337-10391,10452-10484,10479-10524,10682-10767,10768-10780,10911-10936,10952-10992,11162-11188,11248-11267,11799-11810,11913-11960 NOTE ZM_BFc0155H04 HITS PFG_3A-05354.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/10049-10703 NOTE A15378 2715 Dongjin T-DNA Right Border HITS C73552 [GenBank] TYPE Rice EST ctgs EVAL e-103 LOCN Exon COOR W/11008-11072,11160-11236,11768-11973,12067-12165 HITS Os-33183-2-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/11239-11303,11736-11782 HITS PFG_3A-03949.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR C/11401-11835 NOTE A13404 2715 Dongjin T-DNA Right Border HITS PFG_2C-20157.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 3e-28 LOCN Exon COOR C/11765-11835 NOTE C12532 2717 Dongjin T-DNA Right Border HITS PFG_3A-03949.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/11861-12413 NOTE A13405 2715 Dongjin T-DNA Left Border HITS CI370411 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/11942-11972,12068-12488 NOTE CB640945 HITS CB641194 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/11946-11973,12068-12619 NOTE CI522409 CI128307 HITS CU325145 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] TYPE Genoplante T-DNA EVAL 0.0 LOCN Exon COOR W/11946-12269 HITS Os-33183-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 53.07 LOCN Exon COOR W/12068-12330 HITS CI097327 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR3 COOR W/12191-12717 HITS GATCAACTTACTACCCAAAC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/12425-12444 NOTE 0 0 0 0 0 0 4 0 26 0 0 0 0 0 0 0 0 0 HITS GATCAACTTACTACCCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/12425-12441 NOTE 5 0 0 0 0 0 4 0 24 1 0 0 0 0 5 1 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |