RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01010 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL TBC domain containing protein, expressed (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00001 = 12001.m42814); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06748.) ;
COOR W/251-418,1159-1257,2259-2362,3938-4746,4830-4952,5034-5122,5210-5410,6012-6113,6906-6989,7034-7046,7306-7364

HITS CI670954 [GenBank] 
TYPE Rice EST ctgs
EVAL e-148
LOCN Exon
COOR W/1-54,154-419,1160-1240
NOTE CB640244 CB640211 CI573412 CI592663 CI595201 CI601454 CI606577 CI624811 CI567119 CI640574 CI641930 CI644973 CI647878 CI640007 CI657768 CI663042 CI711645 CI749607 CI752080 CI625395 CB681515 
HITS RMD_03Z11FA76 [Seq] [About RMD] [Trait] [iSect Primer] [Request] 
TYPE RMD T-DNA
EVAL e-124
LOCN 300-UTR5
COOR W/1-370
HITS RMD_03Z11FA85 [Seq] [About RMD] [Trait] [iSect Primer] [Request] 
TYPE RMD T-DNA
EVAL 2e-93
LOCN 300-UTR5
COOR W/1-270
HITS J075199P03 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 91.89
LOCN Exon
COOR C/1-70,156-418,1159-1257,2259-2362,3938-4746,4830-4952,5034-5122,5210-5410,6012-6419,6904-6989,7076-7232,7306-7617
HITS CB671731 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/196-419,1160-1256,2258-2360,3936-4330
HITS At2g43490 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-143
LOCN Exon
COOR W/362-381,1150-1185,2259-2293,3936-3970,4033-4062,4434-4466,4608-4653,4705-4717,4789-4802,4829-4871,4886-4897,4981-4999,5000-5012,5033-5061,5108-5118,5210-5277,5400-5463,5464-5480,5481-5518,6315-6349,6424-6460,6914-6933
HITS At3g59570 [T-DNA Express] [Transcriptome] [T-DNA Express Text] 
TYPE Arabidopsis CDS
EVAL e-145
LOCN Exon
COOR W/362-385,1165-1195,1412-1438,2259-2293,3936-3987,4033-4065,4341-4361,4443-4476,4620-4661,4690-4706,4829-4871,4881-4897,4898-4910,4981-4999,5033-5061,5107-5120,5210-5277,5293-5331,5343-5387,5388-5399,5413-5480,6082-6103,6321-6353,6415-6447,6979-7004
HITS RMD_03Z11FA84 [Seq] [About RMD] [Trait] [iSect Primer] [Request] 
TYPE RMD T-DNA
EVAL 8e-15
LOCN Intron
COOR C/493-537
HITS GCTGCTATCAAGTCTTG [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/1801-1817 NOTE 2 0 0 0 0 0 HITS BT038472 [GenBank] TYPE Maize cDNA EVAL 1e-34 LOCN Exon COOR W/2244-2283,4832-4873,5033-5062,5240-5297 NOTE ZM_BFb0274P23 HITS At4g28550 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 4e-34 LOCN Exon COOR W/2244-2283,4832-4873,5033-5062,5240-5297 HITS BI801861 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/2258-2361,3936-4348 HITS RMD_03Z11DF31 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL e-164 LOCN Intron COOR W/3418-3726 HITS RMD_05Z11HM81 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 4e-32 LOCN Intron COOR W/3653-3723 HITS GATCAAAGCTAATGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/4018-4034 NOTE 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS At2g20440 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 1e-31 LOCN Exon COOR W/4707-4721,4832-4873,5033-5062,5240-5318 HITS At4g27100 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 2e-35 LOCN Exon COOR W/4710-4723,4832-4873,5033-5062,5240-5297 HITS At5g54780 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 1e-34 LOCN Exon COOR W/4710-4723,4832-4873,5033-5062,5240-5297 HITS BT061142 [GenBank] TYPE Maize cDNA EVAL 7e-33 LOCN Exon COOR W/4832-4873,5033-5062,5240-5313 NOTE ZM_BFb0115B11 HITS BT068086 [GenBank] TYPE Maize cDNA EVAL 1e-36 LOCN Exon COOR W/4832-4873,5033-5062,5240-5297 NOTE ZM_BFb0039E07 HITS BT036959 [GenBank] TYPE Maize cDNA EVAL 8e-23 LOCN Exon COOR W/4889-4911,5033-5061,5240-5297 NOTE ZM_BFb0148P07 HITS BT063473 [GenBank] TYPE Maize cDNA EVAL 7e-23 LOCN Exon COOR W/4889-4911,5033-5061,5240-5297 NOTE ZM_BFc0067D22 HITS Os-24643-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/4921-4952,5034-5122,5210-5410,6012-6131,6906-6966 HITS PFG_2B-00134.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/4991-5490 NOTE B12302 2707 Hwayoung T-DNA Left Border HITS BT035400 [GenBank] TYPE Maize cDNA EVAL 1e-19 LOCN Exon COOR W/5033-5061,5240-5297 NOTE ZM_BFb0059D13 HITS DAD1G07 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] TYPE Genoplante T-DNA EVAL e-148 LOCN Intron COOR C/6006-6270 HITS PFG_3A-16243.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/6160-6814 NOTE A31216 2715 Dongjin T-DNA Right Border HITS CB671732 [GenBank] TYPE Rice EST ctgs EVAL e-140 LOCN Exon COOR C/6167-6419,6906-6987,7074-7210,7305-7482,7495-7619 NOTE CB681516 CI248199 CI298171 CI317886 CI220977 CR293211 CI034348 CI080111 CI428192 CI392001 CI360386 CI391868 CI448596 CI349934 CI392901 HITS GATCTGCCTATATTCTGCGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR W/6330-6349 NOTE 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCTGCCTATATTCTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Intron COOR W/6330-6346 NOTE 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCGAGGTTTGTAAACAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR C/6449-6468 NOTE 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCGAGGTTTGTAAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Intron COOR C/6452-6468 NOTE 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCCATGAAATTACTACCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR W/6465-6484 NOTE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 HITS GATCCATGAAATTACTA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Intron COOR W/6465-6481 NOTE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 HITS PFG_3A-09077.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/6894-7623 NOTE A20640 2715 Dongjin T-DNA Left Border HITS CI353330 [GenBank] TYPE Rice EST ctgs EVAL 2e-89 LOCN Exon COOR W/7125-7210,7305-7484,7498-7621 NOTE CI411206 CI439433 CI413870 CI417411 CI432999 CI420848 CI411991 CI534523 CI491777 CI531953 CI367842 HITS GATCGATGCTACACCAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR C/7382-7398 NOTE 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 HITS GATCGATGTTGTCATTGTTT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR3 COOR W/7395-7414 NOTE 0 0 8 0 0 0 31 0 22 0 0 3 0 37 0 7 0 0 HITS GATCGATGTTGTCATTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR3 COOR W/7395-7411 NOTE 0 0 7 0 0 0 26 0 19 0 0 4 4 30 0 5 0 2 HITS PFG_3A-09077.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-163 LOCN 300-UTR3 COOR W/7659-8077 NOTE A20641 2715 Dongjin T-DNA Right Border

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |